\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406028647:

Variant ID: vg0406028647 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 6028647
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, A: 0.32, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTACCGTTTCGCCTACCCTTGCGACACGTGGCGCTTTATTACTGGTGGGTAGGCGAACGGTCGCTTGGGTGGGCTATATATTCCCGTTGCTCTTTCC[T/A]
TTACACTGCCACACTTGCCATTTTACCGTGCGCGCTCTCTTTCTCCGTCTCTTCCTTTCACAGCATCTTTCGACCCCTCAGGCGTTTCGCCGAATATCTT

Reverse complement sequence

AAGATATTCGGCGAAACGCCTGAGGGGTCGAAAGATGCTGTGAAAGGAAGAGACGGAGAAAGAGAGCGCGCACGGTAAAATGGCAAGTGTGGCAGTGTAA[A/T]
GGAAAGAGCAACGGGAATATATAGCCCACCCAAGCGACCGTTCGCCTACCCACCAGTAATAAAGCGCCACGTGTCGCAAGGGTAGGCGAAACGGTAAATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.60% 37.10% 3.83% 0.53% NA
All Indica  2759 68.70% 24.90% 5.55% 0.91% NA
All Japonica  1512 34.00% 64.20% 1.79% 0.00% NA
Aus  269 95.90% 4.10% 0.00% 0.00% NA
Indica I  595 93.10% 6.60% 0.34% 0.00% NA
Indica II  465 68.80% 10.50% 15.91% 4.73% NA
Indica III  913 50.30% 43.60% 6.02% 0.11% NA
Indica Intermediate  786 71.50% 25.40% 2.80% 0.25% NA
Temperate Japonica  767 31.20% 68.40% 0.39% 0.00% NA
Tropical Japonica  504 46.20% 50.00% 3.77% 0.00% NA
Japonica Intermediate  241 17.40% 80.50% 2.07% 0.00% NA
VI/Aromatic  96 54.20% 45.80% 0.00% 0.00% NA
Intermediate  90 54.40% 44.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0406028647 T -> DEL N N silent_mutation Average:52.614; most accessible tissue: Minghui63 flag leaf, score: 79.085 N N N N
vg0406028647 T -> A LOC_Os04g11090.1 downstream_gene_variant ; 4220.0bp to feature; MODIFIER silent_mutation Average:52.614; most accessible tissue: Minghui63 flag leaf, score: 79.085 N N N N
vg0406028647 T -> A LOC_Os04g11080.1 intron_variant ; MODIFIER silent_mutation Average:52.614; most accessible tissue: Minghui63 flag leaf, score: 79.085 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0406028647 9.13E-06 NA mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406028647 2.96E-06 3.88E-08 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406028647 NA 4.24E-08 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406028647 2.39E-06 2.39E-06 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406028647 3.03E-07 1.04E-12 mr1626 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406028647 1.47E-06 3.24E-09 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406028647 8.72E-06 8.72E-06 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406028647 9.59E-07 1.85E-09 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406028647 NA 2.06E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406028647 9.90E-06 9.90E-06 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406028647 6.77E-06 1.83E-09 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251