\
| Variant ID: vg0406028647 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6028647 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, A: 0.32, others allele: 0.00, population size: 86. )
AATTTACCGTTTCGCCTACCCTTGCGACACGTGGCGCTTTATTACTGGTGGGTAGGCGAACGGTCGCTTGGGTGGGCTATATATTCCCGTTGCTCTTTCC[T/A]
TTACACTGCCACACTTGCCATTTTACCGTGCGCGCTCTCTTTCTCCGTCTCTTCCTTTCACAGCATCTTTCGACCCCTCAGGCGTTTCGCCGAATATCTT
AAGATATTCGGCGAAACGCCTGAGGGGTCGAAAGATGCTGTGAAAGGAAGAGACGGAGAAAGAGAGCGCGCACGGTAAAATGGCAAGTGTGGCAGTGTAA[A/T]
GGAAAGAGCAACGGGAATATATAGCCCACCCAAGCGACCGTTCGCCTACCCACCAGTAATAAAGCGCCACGTGTCGCAAGGGTAGGCGAAACGGTAAATT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.60% | 37.10% | 3.83% | 0.53% | NA |
| All Indica | 2759 | 68.70% | 24.90% | 5.55% | 0.91% | NA |
| All Japonica | 1512 | 34.00% | 64.20% | 1.79% | 0.00% | NA |
| Aus | 269 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.10% | 6.60% | 0.34% | 0.00% | NA |
| Indica II | 465 | 68.80% | 10.50% | 15.91% | 4.73% | NA |
| Indica III | 913 | 50.30% | 43.60% | 6.02% | 0.11% | NA |
| Indica Intermediate | 786 | 71.50% | 25.40% | 2.80% | 0.25% | NA |
| Temperate Japonica | 767 | 31.20% | 68.40% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 46.20% | 50.00% | 3.77% | 0.00% | NA |
| Japonica Intermediate | 241 | 17.40% | 80.50% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 54.20% | 45.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 44.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406028647 | T -> DEL | N | N | silent_mutation | Average:52.614; most accessible tissue: Minghui63 flag leaf, score: 79.085 | N | N | N | N |
| vg0406028647 | T -> A | LOC_Os04g11090.1 | downstream_gene_variant ; 4220.0bp to feature; MODIFIER | silent_mutation | Average:52.614; most accessible tissue: Minghui63 flag leaf, score: 79.085 | N | N | N | N |
| vg0406028647 | T -> A | LOC_Os04g11080.1 | intron_variant ; MODIFIER | silent_mutation | Average:52.614; most accessible tissue: Minghui63 flag leaf, score: 79.085 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406028647 | 9.13E-06 | NA | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406028647 | 2.96E-06 | 3.88E-08 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406028647 | NA | 4.24E-08 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406028647 | 2.39E-06 | 2.39E-06 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406028647 | 3.03E-07 | 1.04E-12 | mr1626 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406028647 | 1.47E-06 | 3.24E-09 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406028647 | 8.72E-06 | 8.72E-06 | mr1631 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406028647 | 9.59E-07 | 1.85E-09 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406028647 | NA | 2.06E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406028647 | 9.90E-06 | 9.90E-06 | mr1525_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406028647 | 6.77E-06 | 1.83E-09 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |