\
| Variant ID: vg0406010273 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 6010273 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.67, T: 0.32, others allele: 0.00, population size: 191. )
CCATCGAAAATCAGAAAATACATCATGTTAGGTTTCTTACGGTGGTATATGTTCATGAGAGTTCGAGTACTTGACTCATCATATGCACTTGTATTTACAT[G/T]
TAATTGTTTGGGTGAATAGCAAATTTAGTTCCTCAAACTTCACCGAATGATCAATTTGGTCCGCCAGGTTTTATTTTATCCACATAGATCCCCTAAGTAT
ATACTTAGGGGATCTATGTGGATAAAATAAAACCTGGCGGACCAAATTGATCATTCGGTGAAGTTTGAGGAACTAAATTTGCTATTCACCCAAACAATTA[C/A]
ATGTAAATACAAGTGCATATGATGAGTCAAGTACTCGAACTCTCATGAACATATACCACCGTAAGAAACCTAACATGATGTATTTTCTGATTTTCGATGG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.00% | 49.90% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 48.00% | 52.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 66.10% | 33.80% | 0.07% | 0.00% | NA |
| Aus | 269 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 71.90% | 27.90% | 0.17% | 0.00% | NA |
| Indica II | 465 | 36.30% | 63.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 45.20% | 54.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 39.80% | 60.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 70.10% | 29.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 52.60% | 47.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 81.70% | 18.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 42.20% | 57.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0406010273 | G -> T | LOC_Os04g11050.1 | upstream_gene_variant ; 1227.0bp to feature; MODIFIER | silent_mutation | Average:31.318; most accessible tissue: Callus, score: 63.629 | N | N | N | N |
| vg0406010273 | G -> T | LOC_Os04g11060.1 | upstream_gene_variant ; 1594.0bp to feature; MODIFIER | silent_mutation | Average:31.318; most accessible tissue: Callus, score: 63.629 | N | N | N | N |
| vg0406010273 | G -> T | LOC_Os04g11050-LOC_Os04g11060 | intergenic_region ; MODIFIER | silent_mutation | Average:31.318; most accessible tissue: Callus, score: 63.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0406010273 | 6.10E-07 | 3.77E-16 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406010273 | NA | 9.36E-08 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406010273 | NA | 7.87E-06 | mr1312 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406010273 | NA | 1.91E-09 | mr1403 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406010273 | NA | 6.46E-06 | mr1403 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406010273 | 5.89E-07 | 3.94E-10 | mr1525 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406010273 | 2.73E-06 | 2.73E-06 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406010273 | NA | 5.37E-06 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406010273 | NA | 8.38E-06 | mr1830 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406010273 | NA | 4.80E-12 | mr1846 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406010273 | NA | 6.47E-10 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406010273 | 9.83E-06 | 1.08E-07 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406010273 | NA | 8.48E-07 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406010273 | NA | 1.72E-09 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406010273 | NA | 2.06E-07 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406010273 | NA | 4.68E-06 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406010273 | NA | 2.83E-07 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406010273 | NA | 4.87E-15 | mr1846_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406010273 | NA | 7.70E-14 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406010273 | NA | 5.92E-06 | mr1892_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0406010273 | NA | 2.24E-06 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |