Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0406002110:

Variant ID: vg0406002110 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 6002110
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATAGATTAATTAGACTTAATAAATTCGTCTCGCAGTTTACAGGCGGTATCTGTAATTTGTTTTGTTATTACTATACGTTTAATACTTCAAATTTGTGTCC[G/T]
TATATCCGATGTGACACGCCAAAACTTTTCACACTTGGAACTAAACAGGGCTTACATTGTTTTGTGAAAATTCCTTGCGGGCCCCAAAGTTTTTCTGTAT

Reverse complement sequence

ATACAGAAAAACTTTGGGGCCCGCAAGGAATTTTCACAAAACAATGTAAGCCCTGTTTAGTTCCAAGTGTGAAAAGTTTTGGCGTGTCACATCGGATATA[C/A]
GGACACAAATTTGAAGTATTAAACGTATAGTAATAACAAAACAAATTACAGATACCGCCTGTAAACTGCGAGACGAATTTATTAAGTCTAATTAATCTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.60%	1.80%	0.53%	0.00%	NA
All Indica	2759	99.80%	0.10%	0.07%	0.00%	NA
All Japonica	1512	93.20%	5.40%	1.46%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.40%	0.20%	0.43%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	97.10%	1.20%	1.69%	0.00%	NA
Tropical Japonica	504	91.30%	7.70%	0.99%	0.00%	NA
Japonica Intermediate	241	84.60%	13.70%	1.66%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	2.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0406002110	G -> T	LOC_Os04g11050.1	downstream_gene_variant ; 2484.0bp to feature; MODIFIER	silent_mutation	Average:20.774; most accessible tissue: Zhenshan97 young leaf, score: 39.169	N	N	N	N
vg0406002110	G -> T	LOC_Os04g11040-LOC_Os04g11050	intergenic_region ; MODIFIER	silent_mutation	Average:20.774; most accessible tissue: Zhenshan97 young leaf, score: 39.169	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0406002110	7.11E-06	7.11E-06	mr1085	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406002110	NA	2.33E-06	mr1104	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406002110	NA	1.23E-06	mr1155	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406002110	NA	2.13E-07	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406002110	NA	3.69E-06	mr1225	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406002110	NA	4.53E-06	mr1411	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406002110	NA	3.10E-06	mr1437	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406002110	NA	7.46E-06	mr1620	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0406002110	9.00E-07	9.00E-07	mr1663	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251