\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405993315:

Variant ID: vg0405993315 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5993315
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


ATAATTAGTTATACTTTTGCGATGGAAGGAGTACTATTTACTTGTTGGTGCATGATGTAAACAAATGTTAGTTTTACTGCACGTATCTCCTATTGTACCA[A/T]
AGATAATAGGAATGTCTAGATGATCAAATACACGTTGAACTAATTCTATTCAAATTCTCTAAATATTTTCTCTACACTCTTTTATCTAAAGTTGGATGGA

Reverse complement sequence

TCCATCCAACTTTAGATAAAAGAGTGTAGAGAAAATATTTAGAGAATTTGAATAGAATTAGTTCAACGTGTATTTGATCATCTAGACATTCCTATTATCT[T/A]
TGGTACAATAGGAGATACGTGCAGTAAAACTAACATTTGTTTACATCATGCACCAACAAGTAAATAGTACTCCTTCCATCGCAAAAGTATAACTAATTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.70% 2.10% 26.47% 13.69% NA
All Indica  2759 35.20% 3.30% 40.45% 21.09% NA
All Japonica  1512 98.50% 0.00% 1.39% 0.13% NA
Aus  269 58.40% 1.90% 21.19% 18.59% NA
Indica I  595 31.40% 3.70% 34.79% 30.08% NA
Indica II  465 35.10% 4.70% 38.49% 21.72% NA
Indica III  913 32.90% 2.60% 50.16% 14.35% NA
Indica Intermediate  786 40.70% 2.90% 34.61% 21.76% NA
Temperate Japonica  767 99.60% 0.00% 0.26% 0.13% NA
Tropical Japonica  504 98.40% 0.00% 1.39% 0.20% NA
Japonica Intermediate  241 95.00% 0.00% 4.98% 0.00% NA
VI/Aromatic  96 59.40% 3.10% 35.42% 2.08% NA
Intermediate  90 60.00% 2.20% 25.56% 12.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405993315 A -> DEL N N silent_mutation Average:29.987; most accessible tissue: Callus, score: 64.77 N N N N
vg0405993315 A -> T LOC_Os04g11040.1 downstream_gene_variant ; 3081.0bp to feature; MODIFIER silent_mutation Average:29.987; most accessible tissue: Callus, score: 64.77 N N N N
vg0405993315 A -> T LOC_Os04g11040-LOC_Os04g11050 intergenic_region ; MODIFIER silent_mutation Average:29.987; most accessible tissue: Callus, score: 64.77 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405993315 NA 3.87E-15 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405993315 2.47E-06 2.58E-07 mr1035 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405993315 NA 2.16E-07 mr1559 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405993315 NA 2.66E-13 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405993315 NA 1.94E-06 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405993315 NA 1.62E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251