\
| Variant ID: vg0405993315 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5993315 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 97. )
ATAATTAGTTATACTTTTGCGATGGAAGGAGTACTATTTACTTGTTGGTGCATGATGTAAACAAATGTTAGTTTTACTGCACGTATCTCCTATTGTACCA[A/T]
AGATAATAGGAATGTCTAGATGATCAAATACACGTTGAACTAATTCTATTCAAATTCTCTAAATATTTTCTCTACACTCTTTTATCTAAAGTTGGATGGA
TCCATCCAACTTTAGATAAAAGAGTGTAGAGAAAATATTTAGAGAATTTGAATAGAATTAGTTCAACGTGTATTTGATCATCTAGACATTCCTATTATCT[T/A]
TGGTACAATAGGAGATACGTGCAGTAAAACTAACATTTGTTTACATCATGCACCAACAAGTAAATAGTACTCCTTCCATCGCAAAAGTATAACTAATTAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.70% | 2.10% | 26.47% | 13.69% | NA |
| All Indica | 2759 | 35.20% | 3.30% | 40.45% | 21.09% | NA |
| All Japonica | 1512 | 98.50% | 0.00% | 1.39% | 0.13% | NA |
| Aus | 269 | 58.40% | 1.90% | 21.19% | 18.59% | NA |
| Indica I | 595 | 31.40% | 3.70% | 34.79% | 30.08% | NA |
| Indica II | 465 | 35.10% | 4.70% | 38.49% | 21.72% | NA |
| Indica III | 913 | 32.90% | 2.60% | 50.16% | 14.35% | NA |
| Indica Intermediate | 786 | 40.70% | 2.90% | 34.61% | 21.76% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.26% | 0.13% | NA |
| Tropical Japonica | 504 | 98.40% | 0.00% | 1.39% | 0.20% | NA |
| Japonica Intermediate | 241 | 95.00% | 0.00% | 4.98% | 0.00% | NA |
| VI/Aromatic | 96 | 59.40% | 3.10% | 35.42% | 2.08% | NA |
| Intermediate | 90 | 60.00% | 2.20% | 25.56% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405993315 | A -> DEL | N | N | silent_mutation | Average:29.987; most accessible tissue: Callus, score: 64.77 | N | N | N | N |
| vg0405993315 | A -> T | LOC_Os04g11040.1 | downstream_gene_variant ; 3081.0bp to feature; MODIFIER | silent_mutation | Average:29.987; most accessible tissue: Callus, score: 64.77 | N | N | N | N |
| vg0405993315 | A -> T | LOC_Os04g11040-LOC_Os04g11050 | intergenic_region ; MODIFIER | silent_mutation | Average:29.987; most accessible tissue: Callus, score: 64.77 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405993315 | NA | 3.87E-15 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405993315 | 2.47E-06 | 2.58E-07 | mr1035 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405993315 | NA | 2.16E-07 | mr1559 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405993315 | NA | 2.66E-13 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405993315 | NA | 1.94E-06 | mr1626 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405993315 | NA | 1.62E-08 | mr1946 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |