\
| Variant ID: vg0405990141 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5990141 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, G: 0.06, others allele: 0.00, population size: 88. )
TATATATGTTGTGTTAATTAAGGTACTAAGTACTGGTTGTGATGTTGTTTTGATATCAGTAGCCCTAATCCTGAGAATAAGCTGCTTCTCTTCATGGGGA[T/G]
AGAGGAGAGCTTCTAAATATCAATGTATGCAATATTTCTGTTGTGTGCCATAAGCTGTTTACTCTTATGACAAATTAATTAAATCTATTGTCCAGAAAAC
GTTTTCTGGACAATAGATTTAATTAATTTGTCATAAGAGTAAACAGCTTATGGCACACAACAGAAATATTGCATACATTGATATTTAGAAGCTCTCCTCT[A/C]
TCCCCATGAAGAGAAGCAGCTTATTCTCAGGATTAGGGCTACTGATATCAAAACAACATCACAACCAGTACTTAGTACCTTAATTAACACAACATATATA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.50% | 48.50% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 25.20% | 74.70% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 56.10% | 43.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 22.50% | 77.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 23.20% | 76.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 21.90% | 78.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 32.30% | 67.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 53.10% | 46.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 45.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405990141 | T -> G | LOC_Os04g11040.1 | 3_prime_UTR_variant ; 164.0bp to feature; MODIFIER | silent_mutation | Average:51.66; most accessible tissue: Zhenshan97 young leaf, score: 68.315 | N | N | N | N |
| vg0405990141 | T -> G | LOC_Os04g11030.1 | downstream_gene_variant ; 2759.0bp to feature; MODIFIER | silent_mutation | Average:51.66; most accessible tissue: Zhenshan97 young leaf, score: 68.315 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405990141 | NA | 9.08E-16 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405990141 | 2.84E-06 | 1.79E-07 | mr1035 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405990141 | NA | 7.06E-06 | mr1071 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405990141 | NA | 5.96E-06 | mr1080 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405990141 | NA | 2.35E-06 | mr1613 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405990141 | NA | 3.12E-14 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405990141 | 4.39E-06 | 6.03E-07 | mr1626 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405990141 | NA | 4.62E-17 | mr1913 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405990141 | NA | 4.51E-09 | mr1946 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405990141 | NA | 8.20E-13 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |