\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405990141:

Variant ID: vg0405990141 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5990141
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, G: 0.06, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


TATATATGTTGTGTTAATTAAGGTACTAAGTACTGGTTGTGATGTTGTTTTGATATCAGTAGCCCTAATCCTGAGAATAAGCTGCTTCTCTTCATGGGGA[T/G]
AGAGGAGAGCTTCTAAATATCAATGTATGCAATATTTCTGTTGTGTGCCATAAGCTGTTTACTCTTATGACAAATTAATTAAATCTATTGTCCAGAAAAC

Reverse complement sequence

GTTTTCTGGACAATAGATTTAATTAATTTGTCATAAGAGTAAACAGCTTATGGCACACAACAGAAATATTGCATACATTGATATTTAGAAGCTCTCCTCT[A/C]
TCCCCATGAAGAGAAGCAGCTTATTCTCAGGATTAGGGCTACTGATATCAAAACAACATCACAACCAGTACTTAGTACCTTAATTAACACAACATATATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.50% 48.50% 0.02% 0.00% NA
All Indica  2759 25.20% 74.70% 0.04% 0.00% NA
All Japonica  1512 98.30% 1.70% 0.00% 0.00% NA
Aus  269 56.10% 43.90% 0.00% 0.00% NA
Indica I  595 22.50% 77.50% 0.00% 0.00% NA
Indica II  465 23.20% 76.60% 0.22% 0.00% NA
Indica III  913 21.90% 78.10% 0.00% 0.00% NA
Indica Intermediate  786 32.30% 67.70% 0.00% 0.00% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 95.00% 5.00% 0.00% 0.00% NA
VI/Aromatic  96 53.10% 46.90% 0.00% 0.00% NA
Intermediate  90 54.40% 45.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405990141 T -> G LOC_Os04g11040.1 3_prime_UTR_variant ; 164.0bp to feature; MODIFIER silent_mutation Average:51.66; most accessible tissue: Zhenshan97 young leaf, score: 68.315 N N N N
vg0405990141 T -> G LOC_Os04g11030.1 downstream_gene_variant ; 2759.0bp to feature; MODIFIER silent_mutation Average:51.66; most accessible tissue: Zhenshan97 young leaf, score: 68.315 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405990141 NA 9.08E-16 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405990141 2.84E-06 1.79E-07 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405990141 NA 7.06E-06 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405990141 NA 5.96E-06 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405990141 NA 2.35E-06 mr1613 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405990141 NA 3.12E-14 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405990141 4.39E-06 6.03E-07 mr1626 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405990141 NA 4.62E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405990141 NA 4.51E-09 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405990141 NA 8.20E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251