Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405990141:

Variant ID: vg0405990141 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5990141
Reference Allele: T	Alternative Allele: G
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, G: 0.06, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

TATATATGTTGTGTTAATTAAGGTACTAAGTACTGGTTGTGATGTTGTTTTGATATCAGTAGCCCTAATCCTGAGAATAAGCTGCTTCTCTTCATGGGGA[T/G]
AGAGGAGAGCTTCTAAATATCAATGTATGCAATATTTCTGTTGTGTGCCATAAGCTGTTTACTCTTATGACAAATTAATTAAATCTATTGTCCAGAAAAC

Reverse complement sequence

GTTTTCTGGACAATAGATTTAATTAATTTGTCATAAGAGTAAACAGCTTATGGCACACAACAGAAATATTGCATACATTGATATTTAGAAGCTCTCCTCT[A/C]
TCCCCATGAAGAGAAGCAGCTTATTCTCAGGATTAGGGCTACTGATATCAAAACAACATCACAACCAGTACTTAGTACCTTAATTAACACAACATATATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.50%	48.50%	0.02%	0.00%	NA
All Indica	2759	25.20%	74.70%	0.04%	0.00%	NA
All Japonica	1512	98.30%	1.70%	0.00%	0.00%	NA
Aus	269	56.10%	43.90%	0.00%	0.00%	NA
Indica I	595	22.50%	77.50%	0.00%	0.00%	NA
Indica II	465	23.20%	76.60%	0.22%	0.00%	NA
Indica III	913	21.90%	78.10%	0.00%	0.00%	NA
Indica Intermediate	786	32.30%	67.70%	0.00%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	98.00%	2.00%	0.00%	0.00%	NA
Japonica Intermediate	241	95.00%	5.00%	0.00%	0.00%	NA
VI/Aromatic	96	53.10%	46.90%	0.00%	0.00%	NA
Intermediate	90	54.40%	45.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405990141	T -> G	LOC_Os04g11040.1	3_prime_UTR_variant ; 164.0bp to feature; MODIFIER	silent_mutation	Average:51.66; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N
vg0405990141	T -> G	LOC_Os04g11030.1	downstream_gene_variant ; 2759.0bp to feature; MODIFIER	silent_mutation	Average:51.66; most accessible tissue: Zhenshan97 young leaf, score: 68.315	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405990141	NA	9.08E-16	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405990141	2.84E-06	1.79E-07	mr1035	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405990141	NA	7.06E-06	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405990141	NA	5.96E-06	mr1080	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405990141	NA	2.35E-06	mr1613	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405990141	NA	3.12E-14	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405990141	4.39E-06	6.03E-07	mr1626	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405990141	NA	4.62E-17	mr1913	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405990141	NA	4.51E-09	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405990141	NA	8.20E-13	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251