\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405973917:

Variant ID: vg0405973917 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5973917
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.75, G: 0.25, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:


GGAGTGACCATGGCCGCTGAATCCGGTTGGTTGAAGGATGCCGGATCTACTGGCTTAGAGACATGATCGACGGATCCTATGCATCGGAGCTTTACCTGTC[A/G]
CCTTGGTGCTGGAAGGGAGGCAACAGCAGTTGAGGAAGACGGCGCCGACGAGAACAAGGAGAAGAGGAAATGTCGATCTCTTCCCTCGATCATCCAAATC

Reverse complement sequence

GATTTGGATGATCGAGGGAAGAGATCGACATTTCCTCTTCTCCTTGTTCTCGTCGGCGCCGTCTTCCTCAACTGCTGTTGCCTCCCTTCCAGCACCAAGG[T/C]
GACAGGTAAAGCTCCGATGCATAGGATCCGTCGATCATGTCTCTAAGCCAGTAGATCCGGCATCCTTCAACCAACCGGATTCAGCGGCCATGGTCACTCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.10% 30.90% 0.36% 27.57% NA
All Indica  2759 35.70% 43.90% 0.40% 20.08% NA
All Japonica  1512 61.10% 3.40% 0.20% 35.32% NA
Aus  269 0.70% 44.60% 0.00% 54.65% NA
Indica I  595 75.00% 6.70% 1.18% 17.14% NA
Indica II  465 17.40% 64.70% 0.00% 17.85% NA
Indica III  913 21.10% 58.80% 0.22% 19.82% NA
Indica Intermediate  786 33.60% 42.20% 0.25% 23.92% NA
Temperate Japonica  767 67.80% 1.20% 0.13% 30.90% NA
Tropical Japonica  504 43.10% 6.20% 0.40% 50.40% NA
Japonica Intermediate  241 77.60% 4.60% 0.00% 17.84% NA
VI/Aromatic  96 2.10% 49.00% 2.08% 46.88% NA
Intermediate  90 35.60% 37.80% 1.11% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405973917 A -> DEL N N silent_mutation Average:52.974; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0405973917 A -> G LOC_Os04g10990.1 downstream_gene_variant ; 738.0bp to feature; MODIFIER silent_mutation Average:52.974; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0405973917 A -> G LOC_Os04g11004.1 downstream_gene_variant ; 2596.0bp to feature; MODIFIER silent_mutation Average:52.974; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0405973917 A -> G LOC_Os04g10980-LOC_Os04g10990 intergenic_region ; MODIFIER silent_mutation Average:52.974; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405973917 1.52E-06 4.24E-09 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 NA 7.06E-06 mr1059 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 NA 5.16E-08 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 NA 1.39E-06 mr1143 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 NA 1.84E-06 mr1167 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 NA 2.79E-06 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 1.23E-06 1.23E-06 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 NA 6.51E-06 mr1535 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 NA 8.16E-07 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 3.75E-07 2.51E-10 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 3.31E-06 3.31E-06 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 NA 4.11E-06 mr1675 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 NA 3.69E-07 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 NA 3.24E-06 mr1969 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 NA 3.28E-07 mr1995 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 9.60E-07 NA mr1035_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 2.86E-07 1.26E-10 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 NA 1.92E-06 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 NA 2.88E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 NA 7.81E-09 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 1.19E-06 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 1.32E-06 7.22E-11 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 NA 4.74E-08 mr1835_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917 NA 1.28E-12 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251