\
| Variant ID: vg0405973917 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5973917 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.75, G: 0.25, others allele: 0.00, population size: 77. )
GGAGTGACCATGGCCGCTGAATCCGGTTGGTTGAAGGATGCCGGATCTACTGGCTTAGAGACATGATCGACGGATCCTATGCATCGGAGCTTTACCTGTC[A/G]
CCTTGGTGCTGGAAGGGAGGCAACAGCAGTTGAGGAAGACGGCGCCGACGAGAACAAGGAGAAGAGGAAATGTCGATCTCTTCCCTCGATCATCCAAATC
GATTTGGATGATCGAGGGAAGAGATCGACATTTCCTCTTCTCCTTGTTCTCGTCGGCGCCGTCTTCCTCAACTGCTGTTGCCTCCCTTCCAGCACCAAGG[T/C]
GACAGGTAAAGCTCCGATGCATAGGATCCGTCGATCATGTCTCTAAGCCAGTAGATCCGGCATCCTTCAACCAACCGGATTCAGCGGCCATGGTCACTCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.10% | 30.90% | 0.36% | 27.57% | NA |
| All Indica | 2759 | 35.70% | 43.90% | 0.40% | 20.08% | NA |
| All Japonica | 1512 | 61.10% | 3.40% | 0.20% | 35.32% | NA |
| Aus | 269 | 0.70% | 44.60% | 0.00% | 54.65% | NA |
| Indica I | 595 | 75.00% | 6.70% | 1.18% | 17.14% | NA |
| Indica II | 465 | 17.40% | 64.70% | 0.00% | 17.85% | NA |
| Indica III | 913 | 21.10% | 58.80% | 0.22% | 19.82% | NA |
| Indica Intermediate | 786 | 33.60% | 42.20% | 0.25% | 23.92% | NA |
| Temperate Japonica | 767 | 67.80% | 1.20% | 0.13% | 30.90% | NA |
| Tropical Japonica | 504 | 43.10% | 6.20% | 0.40% | 50.40% | NA |
| Japonica Intermediate | 241 | 77.60% | 4.60% | 0.00% | 17.84% | NA |
| VI/Aromatic | 96 | 2.10% | 49.00% | 2.08% | 46.88% | NA |
| Intermediate | 90 | 35.60% | 37.80% | 1.11% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405973917 | A -> DEL | N | N | silent_mutation | Average:52.974; most accessible tissue: Minghui63 young leaf, score: 62.741 | N | N | N | N |
| vg0405973917 | A -> G | LOC_Os04g10990.1 | downstream_gene_variant ; 738.0bp to feature; MODIFIER | silent_mutation | Average:52.974; most accessible tissue: Minghui63 young leaf, score: 62.741 | N | N | N | N |
| vg0405973917 | A -> G | LOC_Os04g11004.1 | downstream_gene_variant ; 2596.0bp to feature; MODIFIER | silent_mutation | Average:52.974; most accessible tissue: Minghui63 young leaf, score: 62.741 | N | N | N | N |
| vg0405973917 | A -> G | LOC_Os04g10980-LOC_Os04g10990 | intergenic_region ; MODIFIER | silent_mutation | Average:52.974; most accessible tissue: Minghui63 young leaf, score: 62.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405973917 | 1.52E-06 | 4.24E-09 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | NA | 7.06E-06 | mr1059 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | NA | 5.16E-08 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | NA | 1.39E-06 | mr1143 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | NA | 1.84E-06 | mr1167 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | NA | 2.79E-06 | mr1525 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | 1.23E-06 | 1.23E-06 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | NA | 6.51E-06 | mr1535 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | NA | 8.16E-07 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | 3.75E-07 | 2.51E-10 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | 3.31E-06 | 3.31E-06 | mr1631 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | NA | 4.11E-06 | mr1675 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | NA | 3.69E-07 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | NA | 3.24E-06 | mr1969 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | NA | 3.28E-07 | mr1995 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | 9.60E-07 | NA | mr1035_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | 2.86E-07 | 1.26E-10 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | NA | 1.92E-06 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | NA | 2.88E-06 | mr1100_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | NA | 7.81E-09 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | 1.19E-06 | NA | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | 1.32E-06 | 7.22E-11 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | NA | 4.74E-08 | mr1835_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405973917 | NA | 1.28E-12 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |