Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405973917:

Variant ID: vg0405973917 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5973917
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.75, G: 0.25, others allele: 0.00, population size: 77. )

Flanking Sequence (100 bp) in Reference Genome:

GGAGTGACCATGGCCGCTGAATCCGGTTGGTTGAAGGATGCCGGATCTACTGGCTTAGAGACATGATCGACGGATCCTATGCATCGGAGCTTTACCTGTC[A/G]
CCTTGGTGCTGGAAGGGAGGCAACAGCAGTTGAGGAAGACGGCGCCGACGAGAACAAGGAGAAGAGGAAATGTCGATCTCTTCCCTCGATCATCCAAATC

Reverse complement sequence

GATTTGGATGATCGAGGGAAGAGATCGACATTTCCTCTTCTCCTTGTTCTCGTCGGCGCCGTCTTCCTCAACTGCTGTTGCCTCCCTTCCAGCACCAAGG[T/C]
GACAGGTAAAGCTCCGATGCATAGGATCCGTCGATCATGTCTCTAAGCCAGTAGATCCGGCATCCTTCAACCAACCGGATTCAGCGGCCATGGTCACTCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.10%	30.90%	0.36%	27.57%	NA
All Indica	2759	35.70%	43.90%	0.40%	20.08%	NA
All Japonica	1512	61.10%	3.40%	0.20%	35.32%	NA
Aus	269	0.70%	44.60%	0.00%	54.65%	NA
Indica I	595	75.00%	6.70%	1.18%	17.14%	NA
Indica II	465	17.40%	64.70%	0.00%	17.85%	NA
Indica III	913	21.10%	58.80%	0.22%	19.82%	NA
Indica Intermediate	786	33.60%	42.20%	0.25%	23.92%	NA
Temperate Japonica	767	67.80%	1.20%	0.13%	30.90%	NA
Tropical Japonica	504	43.10%	6.20%	0.40%	50.40%	NA
Japonica Intermediate	241	77.60%	4.60%	0.00%	17.84%	NA
VI/Aromatic	96	2.10%	49.00%	2.08%	46.88%	NA
Intermediate	90	35.60%	37.80%	1.11%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405973917	A -> DEL	N	N	silent_mutation	Average:52.974; most accessible tissue: Minghui63 young leaf, score: 62.741	N	N	N	N
vg0405973917	A -> G	LOC_Os04g10990.1	downstream_gene_variant ; 738.0bp to feature; MODIFIER	silent_mutation	Average:52.974; most accessible tissue: Minghui63 young leaf, score: 62.741	N	N	N	N
vg0405973917	A -> G	LOC_Os04g11004.1	downstream_gene_variant ; 2596.0bp to feature; MODIFIER	silent_mutation	Average:52.974; most accessible tissue: Minghui63 young leaf, score: 62.741	N	N	N	N
vg0405973917	A -> G	LOC_Os04g10980-LOC_Os04g10990	intergenic_region ; MODIFIER	silent_mutation	Average:52.974; most accessible tissue: Minghui63 young leaf, score: 62.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405973917	1.52E-06	4.24E-09	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	NA	7.06E-06	mr1059	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	NA	5.16E-08	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	NA	1.39E-06	mr1143	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	NA	1.84E-06	mr1167	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	NA	2.79E-06	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	1.23E-06	1.23E-06	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	NA	6.51E-06	mr1535	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	NA	8.16E-07	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	3.75E-07	2.51E-10	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	3.31E-06	3.31E-06	mr1631	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	NA	4.11E-06	mr1675	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	NA	3.69E-07	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	NA	3.24E-06	mr1969	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	NA	3.28E-07	mr1995	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	9.60E-07	NA	mr1035_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	2.86E-07	1.26E-10	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	NA	1.92E-06	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	NA	2.88E-06	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	NA	7.81E-09	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	1.19E-06	NA	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	1.32E-06	7.22E-11	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	NA	4.74E-08	mr1835_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405973917	NA	1.28E-12	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251