Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405918527:

Variant ID: vg0405918527 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5918527
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:

GATACTTTTTAAATTTCTATAATAGTAGATATCTTAACTACTTAAAAGATTCGTATTTTTCCATTCGCCACCCCTCTATTCGTTCGTATTTTTGTCCGTC[C/A]
CTCAAATCCCAATCCGATTTTGATTTTTTGAATGATCAAAAAAATTGAAAAAAAAAGAGAAACCCAAACTTCAACACCTGAAAAACGCAAATATATCGAC

Reverse complement sequence

GTCGATATATTTGCGTTTTTCAGGTGTTGAAGTTTGGGTTTCTCTTTTTTTTTCAATTTTTTTGATCATTCAAAAAATCAAAATCGGATTGGGATTTGAG[G/T]
GACGGACAAAAATACGAACGAATAGAGGGGTGGCGAATGGAAAAATACGAATCTTTTAAGTAGTTAAGATATCTACTATTATAGAAATTTAAAAAGTATC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.00%	24.40%	0.13%	0.49%	NA
All Indica	2759	58.50%	41.20%	0.18%	0.04%	NA
All Japonica	1512	99.70%	0.20%	0.07%	0.00%	NA
Aus	269	92.20%	0.40%	0.00%	7.43%	NA
Indica I	595	22.20%	77.60%	0.17%	0.00%	NA
Indica II	465	80.40%	19.60%	0.00%	0.00%	NA
Indica III	913	68.20%	31.70%	0.11%	0.00%	NA
Indica Intermediate	786	61.80%	37.70%	0.38%	0.13%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405918527	C -> DEL	N	N	silent_mutation	Average:28.818; most accessible tissue: Callus, score: 48.391	N	N	N	N
vg0405918527	C -> A	LOC_Os04g10910.1	upstream_gene_variant ; 3957.0bp to feature; MODIFIER	silent_mutation	Average:28.818; most accessible tissue: Callus, score: 48.391	N	N	N	N
vg0405918527	C -> A	LOC_Os04g10924.1	downstream_gene_variant ; 1770.0bp to feature; MODIFIER	silent_mutation	Average:28.818; most accessible tissue: Callus, score: 48.391	N	N	N	N
vg0405918527	C -> A	LOC_Os04g10910-LOC_Os04g10924	intergenic_region ; MODIFIER	silent_mutation	Average:28.818; most accessible tissue: Callus, score: 48.391	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405918527	NA	4.47E-06	mr1608	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405918527	NA	5.13E-06	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405918527	NA	3.39E-07	mr1846	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405918527	NA	3.39E-08	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405918527	NA	5.01E-06	mr1123_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405918527	NA	7.23E-08	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405918527	NA	4.97E-12	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405918527	NA	2.68E-09	mr1835_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405918527	NA	3.44E-11	mr1846_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251