\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405918527:

Variant ID: vg0405918527 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5918527
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


GATACTTTTTAAATTTCTATAATAGTAGATATCTTAACTACTTAAAAGATTCGTATTTTTCCATTCGCCACCCCTCTATTCGTTCGTATTTTTGTCCGTC[C/A]
CTCAAATCCCAATCCGATTTTGATTTTTTGAATGATCAAAAAAATTGAAAAAAAAAGAGAAACCCAAACTTCAACACCTGAAAAACGCAAATATATCGAC

Reverse complement sequence

GTCGATATATTTGCGTTTTTCAGGTGTTGAAGTTTGGGTTTCTCTTTTTTTTTCAATTTTTTTGATCATTCAAAAAATCAAAATCGGATTGGGATTTGAG[G/T]
GACGGACAAAAATACGAACGAATAGAGGGGTGGCGAATGGAAAAATACGAATCTTTTAAGTAGTTAAGATATCTACTATTATAGAAATTTAAAAAGTATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.00% 24.40% 0.13% 0.49% NA
All Indica  2759 58.50% 41.20% 0.18% 0.04% NA
All Japonica  1512 99.70% 0.20% 0.07% 0.00% NA
Aus  269 92.20% 0.40% 0.00% 7.43% NA
Indica I  595 22.20% 77.60% 0.17% 0.00% NA
Indica II  465 80.40% 19.60% 0.00% 0.00% NA
Indica III  913 68.20% 31.70% 0.11% 0.00% NA
Indica Intermediate  786 61.80% 37.70% 0.38% 0.13% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405918527 C -> DEL N N silent_mutation Average:28.818; most accessible tissue: Callus, score: 48.391 N N N N
vg0405918527 C -> A LOC_Os04g10910.1 upstream_gene_variant ; 3957.0bp to feature; MODIFIER silent_mutation Average:28.818; most accessible tissue: Callus, score: 48.391 N N N N
vg0405918527 C -> A LOC_Os04g10924.1 downstream_gene_variant ; 1770.0bp to feature; MODIFIER silent_mutation Average:28.818; most accessible tissue: Callus, score: 48.391 N N N N
vg0405918527 C -> A LOC_Os04g10910-LOC_Os04g10924 intergenic_region ; MODIFIER silent_mutation Average:28.818; most accessible tissue: Callus, score: 48.391 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405918527 NA 4.47E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405918527 NA 5.13E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405918527 NA 3.39E-07 mr1846 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405918527 NA 3.39E-08 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405918527 NA 5.01E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405918527 NA 7.23E-08 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405918527 NA 4.97E-12 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405918527 NA 2.68E-09 mr1835_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405918527 NA 3.44E-11 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251