\
| Variant ID: vg0405918527 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5918527 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 124. )
GATACTTTTTAAATTTCTATAATAGTAGATATCTTAACTACTTAAAAGATTCGTATTTTTCCATTCGCCACCCCTCTATTCGTTCGTATTTTTGTCCGTC[C/A]
CTCAAATCCCAATCCGATTTTGATTTTTTGAATGATCAAAAAAATTGAAAAAAAAAGAGAAACCCAAACTTCAACACCTGAAAAACGCAAATATATCGAC
GTCGATATATTTGCGTTTTTCAGGTGTTGAAGTTTGGGTTTCTCTTTTTTTTTCAATTTTTTTGATCATTCAAAAAATCAAAATCGGATTGGGATTTGAG[G/T]
GACGGACAAAAATACGAACGAATAGAGGGGTGGCGAATGGAAAAATACGAATCTTTTAAGTAGTTAAGATATCTACTATTATAGAAATTTAAAAAGTATC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.00% | 24.40% | 0.13% | 0.49% | NA |
| All Indica | 2759 | 58.50% | 41.20% | 0.18% | 0.04% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 92.20% | 0.40% | 0.00% | 7.43% | NA |
| Indica I | 595 | 22.20% | 77.60% | 0.17% | 0.00% | NA |
| Indica II | 465 | 80.40% | 19.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 68.20% | 31.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 61.80% | 37.70% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405918527 | C -> DEL | N | N | silent_mutation | Average:28.818; most accessible tissue: Callus, score: 48.391 | N | N | N | N |
| vg0405918527 | C -> A | LOC_Os04g10910.1 | upstream_gene_variant ; 3957.0bp to feature; MODIFIER | silent_mutation | Average:28.818; most accessible tissue: Callus, score: 48.391 | N | N | N | N |
| vg0405918527 | C -> A | LOC_Os04g10924.1 | downstream_gene_variant ; 1770.0bp to feature; MODIFIER | silent_mutation | Average:28.818; most accessible tissue: Callus, score: 48.391 | N | N | N | N |
| vg0405918527 | C -> A | LOC_Os04g10910-LOC_Os04g10924 | intergenic_region ; MODIFIER | silent_mutation | Average:28.818; most accessible tissue: Callus, score: 48.391 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405918527 | NA | 4.47E-06 | mr1608 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405918527 | NA | 5.13E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405918527 | NA | 3.39E-07 | mr1846 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405918527 | NA | 3.39E-08 | mr1925 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405918527 | NA | 5.01E-06 | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405918527 | NA | 7.23E-08 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405918527 | NA | 4.97E-12 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405918527 | NA | 2.68E-09 | mr1835_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405918527 | NA | 3.44E-11 | mr1846_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |