\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405913502:

Variant ID: vg0405913502 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5913502
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.07, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTAGAGCCAATTTAATTTGTACATATGTGTCGGTGGATAAATAATCACTGTCCATTTTTTTCGTCTATTCATGTGCTTACCCAAAGCACTTATTATCT[C/T]
TACTACTTAAAAAAGTTCGTAGTGGTGGCGGTGAAGCCAATCCTGACGCACACGAATGTGAGCCGTCGATCGCCGAGTCCGACGGCGCTATTGCTTTTCT

Reverse complement sequence

AGAAAAGCAATAGCGCCGTCGGACTCGGCGATCGACGGCTCACATTCGTGTGCGTCAGGATTGGCTTCACCGCCACCACTACGAACTTTTTTAAGTAGTA[G/A]
AGATAATAAGTGCTTTGGGTAAGCACATGAATAGACGAAAAAAATGGACAGTGATTATTTATCCACCGACACATATGTACAAATTAAATTGGCTCTAACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.40% 12.20% 0.44% 0.00% NA
All Indica  2759 86.10% 13.90% 0.04% 0.00% NA
All Japonica  1512 99.60% 0.40% 0.00% 0.00% NA
Aus  269 49.80% 43.90% 6.32% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 61.50% 38.50% 0.00% 0.00% NA
Indica III  913 92.00% 8.00% 0.00% 0.00% NA
Indica Intermediate  786 84.00% 15.90% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 49.00% 49.00% 2.08% 0.00% NA
Intermediate  90 74.40% 24.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405913502 C -> T LOC_Os04g10900.1 downstream_gene_variant ; 3796.0bp to feature; MODIFIER silent_mutation Average:51.613; most accessible tissue: Callus, score: 75.754 N N N N
vg0405913502 C -> T LOC_Os04g10910.1 intron_variant ; MODIFIER silent_mutation Average:51.613; most accessible tissue: Callus, score: 75.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405913502 NA 4.41E-08 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405913502 1.23E-07 4.21E-17 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405913502 2.86E-09 7.00E-13 mr1062 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405913502 NA 1.30E-09 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405913502 NA 1.05E-08 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405913502 3.02E-07 1.33E-07 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405913502 1.09E-08 6.47E-09 mr1525 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405913502 NA 8.27E-09 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405913502 NA 7.74E-08 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405913502 NA 1.28E-09 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405913502 1.75E-08 6.32E-21 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405913502 2.35E-13 1.07E-22 mr1062_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405913502 NA 4.06E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405913502 NA 3.06E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405913502 NA 1.68E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405913502 NA 1.09E-06 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405913502 5.19E-09 4.67E-10 mr1525_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405913502 NA 4.64E-16 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405913502 NA 2.13E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405913502 NA 1.76E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251