| Variant ID: vg0405898112 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5898112 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTTACCTTGAGAAGCAATCGTCATCTCAAAATTGAACACTCATGGGGAGTATACCGCCAAAATACCTACGAACGAGAAGATGTCGAGGCCTCCGTGTTGG[A/G]
GTTAGAAATAAGAAATTTTAGAATCCAACACTGAGTCACACAACCAGTAGAACCAGTAGGTACATATGCACTGACAAAATCAGAATCAGACTTACCTGAA
TTCAGGTAAGTCTGATTCTGATTTTGTCAGTGCATATGTACCTACTGGTTCTACTGGTTGTGTGACTCAGTGTTGGATTCTAAAATTTCTTATTTCTAAC[T/C]
CCAACACGGAGGCCTCGACATCTTCTCGTTCGTAGGTATTTTGGCGGTATACTCCCCATGAGTGTTCAATTTTGAGATGACGATTGCTTCTCAAGGTAAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 25.10% | 0.10% | 1.99% | 72.85% | NA |
| All Indica | 2759 | 8.00% | 0.10% | 0.91% | 90.94% | NA |
| All Japonica | 1512 | 59.70% | 0.00% | 0.99% | 39.29% | NA |
| Aus | 269 | 10.40% | 0.00% | 19.70% | 69.89% | NA |
| Indica I | 595 | 2.40% | 0.00% | 0.00% | 97.65% | NA |
| Indica II | 465 | 13.10% | 0.00% | 1.94% | 84.95% | NA |
| Indica III | 913 | 10.40% | 0.10% | 0.66% | 88.83% | NA |
| Indica Intermediate | 786 | 6.50% | 0.40% | 1.27% | 91.86% | NA |
| Temperate Japonica | 767 | 66.40% | 0.00% | 1.04% | 32.59% | NA |
| Tropical Japonica | 504 | 42.90% | 0.00% | 0.60% | 56.55% | NA |
| Japonica Intermediate | 241 | 73.90% | 0.00% | 1.66% | 24.48% | NA |
| VI/Aromatic | 96 | 7.30% | 0.00% | 0.00% | 92.71% | NA |
| Intermediate | 90 | 28.90% | 0.00% | 1.11% | 70.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405898112 | A -> DEL | N | N | silent_mutation | Average:12.315; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0405898112 | A -> G | LOC_Os04g10870.1 | upstream_gene_variant ; 2004.0bp to feature; MODIFIER | silent_mutation | Average:12.315; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0405898112 | A -> G | LOC_Os04g10860.1 | downstream_gene_variant ; 4878.0bp to feature; MODIFIER | silent_mutation | Average:12.315; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0405898112 | A -> G | LOC_Os04g10880.1 | downstream_gene_variant ; 938.0bp to feature; MODIFIER | silent_mutation | Average:12.315; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| vg0405898112 | A -> G | LOC_Os04g10870-LOC_Os04g10880 | intergenic_region ; MODIFIER | silent_mutation | Average:12.315; most accessible tissue: Zhenshan97 panicle, score: 20.424 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405898112 | NA | 4.96E-13 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898112 | 1.95E-07 | 1.80E-17 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898112 | 4.68E-06 | 1.28E-06 | mr1062 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898112 | NA | 1.04E-14 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898112 | 3.00E-08 | NA | mr1525 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898112 | 5.58E-07 | 5.58E-07 | mr1525 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898112 | NA | 3.10E-06 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898112 | NA | 7.37E-12 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898112 | NA | 4.17E-07 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405898112 | 2.34E-06 | 6.63E-23 | mr1698 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/