Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405898112:

Variant ID: vg0405898112 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5898112
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTACCTTGAGAAGCAATCGTCATCTCAAAATTGAACACTCATGGGGAGTATACCGCCAAAATACCTACGAACGAGAAGATGTCGAGGCCTCCGTGTTGG[A/G]
GTTAGAAATAAGAAATTTTAGAATCCAACACTGAGTCACACAACCAGTAGAACCAGTAGGTACATATGCACTGACAAAATCAGAATCAGACTTACCTGAA

Reverse complement sequence

TTCAGGTAAGTCTGATTCTGATTTTGTCAGTGCATATGTACCTACTGGTTCTACTGGTTGTGTGACTCAGTGTTGGATTCTAAAATTTCTTATTTCTAAC[T/C]
CCAACACGGAGGCCTCGACATCTTCTCGTTCGTAGGTATTTTGGCGGTATACTCCCCATGAGTGTTCAATTTTGAGATGACGATTGCTTCTCAAGGTAAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	25.10%	0.10%	1.99%	72.85%	NA
All Indica	2759	8.00%	0.10%	0.91%	90.94%	NA
All Japonica	1512	59.70%	0.00%	0.99%	39.29%	NA
Aus	269	10.40%	0.00%	19.70%	69.89%	NA
Indica I	595	2.40%	0.00%	0.00%	97.65%	NA
Indica II	465	13.10%	0.00%	1.94%	84.95%	NA
Indica III	913	10.40%	0.10%	0.66%	88.83%	NA
Indica Intermediate	786	6.50%	0.40%	1.27%	91.86%	NA
Temperate Japonica	767	66.40%	0.00%	1.04%	32.59%	NA
Tropical Japonica	504	42.90%	0.00%	0.60%	56.55%	NA
Japonica Intermediate	241	73.90%	0.00%	1.66%	24.48%	NA
VI/Aromatic	96	7.30%	0.00%	0.00%	92.71%	NA
Intermediate	90	28.90%	0.00%	1.11%	70.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405898112	A -> DEL	N	N	silent_mutation	Average:12.315; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0405898112	A -> G	LOC_Os04g10870.1	upstream_gene_variant ; 2004.0bp to feature; MODIFIER	silent_mutation	Average:12.315; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0405898112	A -> G	LOC_Os04g10860.1	downstream_gene_variant ; 4878.0bp to feature; MODIFIER	silent_mutation	Average:12.315; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0405898112	A -> G	LOC_Os04g10880.1	downstream_gene_variant ; 938.0bp to feature; MODIFIER	silent_mutation	Average:12.315; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0405898112	A -> G	LOC_Os04g10870-LOC_Os04g10880	intergenic_region ; MODIFIER	silent_mutation	Average:12.315; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405898112	NA	4.96E-13	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898112	1.95E-07	1.80E-17	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898112	4.68E-06	1.28E-06	mr1062	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898112	NA	1.04E-14	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898112	3.00E-08	NA	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898112	5.58E-07	5.58E-07	mr1525	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898112	NA	3.10E-06	mr1622	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898112	NA	7.37E-12	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898112	NA	4.17E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898112	2.34E-06	6.63E-23	mr1698	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898112	NA	3.27E-10	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898112	4.24E-08	9.57E-19	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898112	NA	2.54E-06	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405898112	3.41E-06	6.61E-31	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251