\
| Variant ID: vg0405896767 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5896767 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 89. )
AACACATTGGCAAACCTCATCAAAAAAATGTTTTGGTGTTTGGAAAAATAAAAATAAAAGTGGTAAAAAACACACTTCGTACAAATGTACACATCGTGCT[C/T]
AAAAATCCAAAAGAAAACTTCTCCCCCTTTTTAAAAGAAAGAAATTCTCAATTGTACACATCGTGCTCAAAAATCCAAAAGAAAGAAATTCCCCCAATTG
CAATTGGGGGAATTTCTTTCTTTTGGATTTTTGAGCACGATGTGTACAATTGAGAATTTCTTTCTTTTAAAAAGGGGGAGAAGTTTTCTTTTGGATTTTT[G/A]
AGCACGATGTGTACATTTGTACGAAGTGTGTTTTTTACCACTTTTATTTTTATTTTTCCAAACACCAAAACATTTTTTTGATGAGGTTTGCCAATGTGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.80% | 0.60% | 19.53% | 49.11% | NA |
| All Indica | 2759 | 16.10% | 0.80% | 27.80% | 55.27% | NA |
| All Japonica | 1512 | 61.10% | 0.00% | 2.38% | 36.51% | NA |
| Aus | 269 | 14.50% | 1.10% | 31.97% | 52.42% | NA |
| Indica I | 595 | 9.60% | 0.70% | 40.50% | 49.24% | NA |
| Indica II | 465 | 19.80% | 0.40% | 20.65% | 59.14% | NA |
| Indica III | 913 | 20.30% | 1.30% | 24.53% | 53.89% | NA |
| Indica Intermediate | 786 | 14.00% | 0.60% | 26.21% | 59.16% | NA |
| Temperate Japonica | 767 | 66.10% | 0.00% | 1.56% | 32.33% | NA |
| Tropical Japonica | 504 | 46.80% | 0.00% | 3.97% | 49.21% | NA |
| Japonica Intermediate | 241 | 75.10% | 0.00% | 1.66% | 23.24% | NA |
| VI/Aromatic | 96 | 16.70% | 1.00% | 18.75% | 63.54% | NA |
| Intermediate | 90 | 34.40% | 1.10% | 17.78% | 46.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405896767 | C -> DEL | N | N | silent_mutation | Average:8.263; most accessible tissue: Callus, score: 17.014 | N | N | N | N |
| vg0405896767 | C -> T | LOC_Os04g10870.1 | upstream_gene_variant ; 659.0bp to feature; MODIFIER | silent_mutation | Average:8.263; most accessible tissue: Callus, score: 17.014 | N | N | N | N |
| vg0405896767 | C -> T | LOC_Os04g10860.1 | downstream_gene_variant ; 3533.0bp to feature; MODIFIER | silent_mutation | Average:8.263; most accessible tissue: Callus, score: 17.014 | N | N | N | N |
| vg0405896767 | C -> T | LOC_Os04g10880.1 | downstream_gene_variant ; 2283.0bp to feature; MODIFIER | silent_mutation | Average:8.263; most accessible tissue: Callus, score: 17.014 | N | N | N | N |
| vg0405896767 | C -> T | LOC_Os04g10870-LOC_Os04g10880 | intergenic_region ; MODIFIER | silent_mutation | Average:8.263; most accessible tissue: Callus, score: 17.014 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405896767 | 7.93E-06 | 2.46E-07 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405896767 | 4.96E-06 | 8.11E-08 | mr1117 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405896767 | 1.87E-06 | 3.01E-08 | mr1119 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405896767 | NA | 3.12E-06 | mr1240 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405896767 | 2.84E-07 | 2.57E-08 | mr1242 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405896767 | 5.13E-07 | 5.27E-09 | mr1247 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405896767 | 5.35E-07 | 4.65E-09 | mr1496 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405896767 | NA | 6.69E-06 | mr1917 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405896767 | NA | 4.47E-06 | mr1113_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405896767 | NA | 3.04E-07 | mr1114_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405896767 | 1.57E-06 | 1.76E-08 | mr1117_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405896767 | 3.22E-06 | 2.41E-08 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405896767 | NA | 3.06E-06 | mr1120_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405896767 | 6.68E-06 | 3.14E-08 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405896767 | NA | 9.08E-06 | mr1242_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405896767 | NA | 7.52E-07 | mr1247_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405896767 | NA | 4.64E-07 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |