Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0405896767:

Variant ID: vg0405896767 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5896767
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

AACACATTGGCAAACCTCATCAAAAAAATGTTTTGGTGTTTGGAAAAATAAAAATAAAAGTGGTAAAAAACACACTTCGTACAAATGTACACATCGTGCT[C/T]
AAAAATCCAAAAGAAAACTTCTCCCCCTTTTTAAAAGAAAGAAATTCTCAATTGTACACATCGTGCTCAAAAATCCAAAAGAAAGAAATTCCCCCAATTG

Reverse complement sequence

CAATTGGGGGAATTTCTTTCTTTTGGATTTTTGAGCACGATGTGTACAATTGAGAATTTCTTTCTTTTAAAAAGGGGGAGAAGTTTTCTTTTGGATTTTT[G/A]
AGCACGATGTGTACATTTGTACGAAGTGTGTTTTTTACCACTTTTATTTTTATTTTTCCAAACACCAAAACATTTTTTTGATGAGGTTTGCCAATGTGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	30.80%	0.60%	19.53%	49.11%	NA
All Indica	2759	16.10%	0.80%	27.80%	55.27%	NA
All Japonica	1512	61.10%	0.00%	2.38%	36.51%	NA
Aus	269	14.50%	1.10%	31.97%	52.42%	NA
Indica I	595	9.60%	0.70%	40.50%	49.24%	NA
Indica II	465	19.80%	0.40%	20.65%	59.14%	NA
Indica III	913	20.30%	1.30%	24.53%	53.89%	NA
Indica Intermediate	786	14.00%	0.60%	26.21%	59.16%	NA
Temperate Japonica	767	66.10%	0.00%	1.56%	32.33%	NA
Tropical Japonica	504	46.80%	0.00%	3.97%	49.21%	NA
Japonica Intermediate	241	75.10%	0.00%	1.66%	23.24%	NA
VI/Aromatic	96	16.70%	1.00%	18.75%	63.54%	NA
Intermediate	90	34.40%	1.10%	17.78%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405896767	C -> DEL	N	N	silent_mutation	Average:8.263; most accessible tissue: Callus, score: 17.014	N	N	N	N
vg0405896767	C -> T	LOC_Os04g10870.1	upstream_gene_variant ; 659.0bp to feature; MODIFIER	silent_mutation	Average:8.263; most accessible tissue: Callus, score: 17.014	N	N	N	N
vg0405896767	C -> T	LOC_Os04g10860.1	downstream_gene_variant ; 3533.0bp to feature; MODIFIER	silent_mutation	Average:8.263; most accessible tissue: Callus, score: 17.014	N	N	N	N
vg0405896767	C -> T	LOC_Os04g10880.1	downstream_gene_variant ; 2283.0bp to feature; MODIFIER	silent_mutation	Average:8.263; most accessible tissue: Callus, score: 17.014	N	N	N	N
vg0405896767	C -> T	LOC_Os04g10870-LOC_Os04g10880	intergenic_region ; MODIFIER	silent_mutation	Average:8.263; most accessible tissue: Callus, score: 17.014	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405896767	7.93E-06	2.46E-07	mr1114	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767	4.96E-06	8.11E-08	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767	1.87E-06	3.01E-08	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767	NA	3.12E-06	mr1240	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767	2.84E-07	2.57E-08	mr1242	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767	5.13E-07	5.27E-09	mr1247	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767	5.35E-07	4.65E-09	mr1496	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767	NA	6.69E-06	mr1917	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767	NA	4.47E-06	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767	NA	3.04E-07	mr1114_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767	1.57E-06	1.76E-08	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767	3.22E-06	2.41E-08	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767	NA	3.06E-06	mr1120_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767	6.68E-06	3.14E-08	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767	NA	9.08E-06	mr1242_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767	NA	7.52E-07	mr1247_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767	NA	4.64E-07	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251