\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405896767:

Variant ID: vg0405896767 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5896767
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


AACACATTGGCAAACCTCATCAAAAAAATGTTTTGGTGTTTGGAAAAATAAAAATAAAAGTGGTAAAAAACACACTTCGTACAAATGTACACATCGTGCT[C/T]
AAAAATCCAAAAGAAAACTTCTCCCCCTTTTTAAAAGAAAGAAATTCTCAATTGTACACATCGTGCTCAAAAATCCAAAAGAAAGAAATTCCCCCAATTG

Reverse complement sequence

CAATTGGGGGAATTTCTTTCTTTTGGATTTTTGAGCACGATGTGTACAATTGAGAATTTCTTTCTTTTAAAAAGGGGGAGAAGTTTTCTTTTGGATTTTT[G/A]
AGCACGATGTGTACATTTGTACGAAGTGTGTTTTTTACCACTTTTATTTTTATTTTTCCAAACACCAAAACATTTTTTTGATGAGGTTTGCCAATGTGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.80% 0.60% 19.53% 49.11% NA
All Indica  2759 16.10% 0.80% 27.80% 55.27% NA
All Japonica  1512 61.10% 0.00% 2.38% 36.51% NA
Aus  269 14.50% 1.10% 31.97% 52.42% NA
Indica I  595 9.60% 0.70% 40.50% 49.24% NA
Indica II  465 19.80% 0.40% 20.65% 59.14% NA
Indica III  913 20.30% 1.30% 24.53% 53.89% NA
Indica Intermediate  786 14.00% 0.60% 26.21% 59.16% NA
Temperate Japonica  767 66.10% 0.00% 1.56% 32.33% NA
Tropical Japonica  504 46.80% 0.00% 3.97% 49.21% NA
Japonica Intermediate  241 75.10% 0.00% 1.66% 23.24% NA
VI/Aromatic  96 16.70% 1.00% 18.75% 63.54% NA
Intermediate  90 34.40% 1.10% 17.78% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405896767 C -> DEL N N silent_mutation Average:8.263; most accessible tissue: Callus, score: 17.014 N N N N
vg0405896767 C -> T LOC_Os04g10870.1 upstream_gene_variant ; 659.0bp to feature; MODIFIER silent_mutation Average:8.263; most accessible tissue: Callus, score: 17.014 N N N N
vg0405896767 C -> T LOC_Os04g10860.1 downstream_gene_variant ; 3533.0bp to feature; MODIFIER silent_mutation Average:8.263; most accessible tissue: Callus, score: 17.014 N N N N
vg0405896767 C -> T LOC_Os04g10880.1 downstream_gene_variant ; 2283.0bp to feature; MODIFIER silent_mutation Average:8.263; most accessible tissue: Callus, score: 17.014 N N N N
vg0405896767 C -> T LOC_Os04g10870-LOC_Os04g10880 intergenic_region ; MODIFIER silent_mutation Average:8.263; most accessible tissue: Callus, score: 17.014 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405896767 7.93E-06 2.46E-07 mr1114 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767 4.96E-06 8.11E-08 mr1117 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767 1.87E-06 3.01E-08 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767 NA 3.12E-06 mr1240 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767 2.84E-07 2.57E-08 mr1242 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767 5.13E-07 5.27E-09 mr1247 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767 5.35E-07 4.65E-09 mr1496 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767 NA 6.69E-06 mr1917 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767 NA 4.47E-06 mr1113_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767 NA 3.04E-07 mr1114_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767 1.57E-06 1.76E-08 mr1117_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767 3.22E-06 2.41E-08 mr1119_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767 NA 3.06E-06 mr1120_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767 6.68E-06 3.14E-08 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767 NA 9.08E-06 mr1242_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767 NA 7.52E-07 mr1247_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405896767 NA 4.64E-07 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251