Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405894601:

Variant ID: vg0405894601 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5894601
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:

TGGCCGCCGCCTCCTCATCCTGGATGACTACGATTGGTGGCGTATTGCTGGCATTGGTGCCATGTGTGGTGAGCTGAGGACCGTGCATTAGCTCTTCGCC[A/G]
TCTACAACCATGTCTTTCATCATCTACCCACAAATGTGAAGCAAGATTAAAACATATTGAATTAAAATATGGACAACCAAATTGAAGAGGAGACCATTAA

Reverse complement sequence

TTAATGGTCTCCTCTTCAATTTGGTTGTCCATATTTTAATTCAATATGTTTTAATCTTGCTTCACATTTGTGGGTAGATGATGAAAGACATGGTTGTAGA[T/C]
GGCGAAGAGCTAATGCACGGTCCTCAGCTCACCACACATGGCACCAATGCCAGCAATACGCCACCAATCGTAGTCATCCAGGATGAGGAGGCGGCGGCCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.10%	24.50%	0.57%	29.88%	NA
All Indica	2759	58.50%	7.50%	0.80%	33.24%	NA
All Japonica	1512	12.80%	59.50%	0.20%	27.51%	NA
Aus	269	77.70%	8.20%	0.00%	14.13%	NA
Indica I	595	62.50%	1.50%	1.01%	34.96%	NA
Indica II	465	34.60%	12.70%	0.86%	51.83%	NA
Indica III	913	71.60%	9.90%	0.33%	18.18%	NA
Indica Intermediate	786	54.20%	6.20%	1.15%	38.42%	NA
Temperate Japonica	767	1.70%	67.40%	0.26%	30.64%	NA
Tropical Japonica	504	31.30%	40.70%	0.20%	27.78%	NA
Japonica Intermediate	241	9.50%	73.40%	0.00%	17.01%	NA
VI/Aromatic	96	80.20%	7.30%	0.00%	12.50%	NA
Intermediate	90	41.10%	24.40%	2.22%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405894601	A -> DEL	LOC_Os04g10870.1	N	frameshift_variant	Average:23.3; most accessible tissue: Callus, score: 44.256	N	N	N	N
vg0405894601	A -> G	LOC_Os04g10870.1	synonymous_variant ; p.Asp105Asp; LOW	synonymous_codon	Average:23.3; most accessible tissue: Callus, score: 44.256	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405894601	NA	3.50E-06	mr1130	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405894601	NA	2.75E-15	mr1143	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405894601	NA	3.30E-16	mr1167	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405894601	NA	4.72E-07	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405894601	NA	4.84E-08	mr1227	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405894601	NA	1.45E-06	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405894601	4.60E-06	4.60E-06	mr1351	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405894601	NA	2.20E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405894601	NA	3.74E-06	mr1500	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405894601	NA	1.33E-16	mr1535	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405894601	NA	1.14E-08	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405894601	NA	8.29E-07	mr1606	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405894601	NA	4.09E-09	mr1660	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405894601	NA	5.02E-16	mr1675	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405894601	NA	5.10E-08	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405894601	NA	2.43E-08	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405894601	NA	2.82E-14	mr1726	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405894601	NA	1.09E-10	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405894601	NA	3.37E-11	mr1866	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405894601	NA	3.96E-15	mr1969	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405894601	NA	3.37E-17	mr1995	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251