\
| Variant ID: vg0405892464 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5892464 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, A: 0.06, others allele: 0.00, population size: 78. )
CGTTGTTGTGTCGTGGATAGGTGGACAATGGGAGCAAAGGCGGCATTTAGGTCAGACAGGAATACCGATCCTAATGTGTGGTCTAAACACATGGTTCGTT[T/A]
TCGTAGCCTCCGAAATCTGGGTAGTGATGCTTTCTTTGAGGCCGCTAGGAACCCTGAGCAGACAGAAAAGGCGATGGATTTCTTAAAGGGGATTTTGGAT
ATCCAAAATCCCCTTTAAGAAATCCATCGCCTTTTCTGTCTGCTCAGGGTTCCTAGCGGCCTCAAAGAAAGCATCACTACCCAGATTTCGGAGGCTACGA[A/T]
AACGAACCATGTGTTTAGACCACACATTAGGATCGGTATTCCTGTCTGACCTAAATGCCGCCTTTGCTCCCATTGTCCACCTATCCACGACACAACAACG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.80% | 2.90% | 1.86% | 68.39% | NA |
| All Indica | 2759 | 8.60% | 3.70% | 2.50% | 85.21% | NA |
| All Japonica | 1512 | 64.20% | 0.10% | 0.33% | 35.45% | NA |
| Aus | 269 | 9.30% | 11.90% | 3.35% | 75.46% | NA |
| Indica I | 595 | 2.40% | 9.90% | 6.39% | 81.34% | NA |
| Indica II | 465 | 14.20% | 0.90% | 1.08% | 83.87% | NA |
| Indica III | 913 | 11.00% | 0.40% | 1.20% | 87.40% | NA |
| Indica Intermediate | 786 | 7.40% | 4.30% | 1.91% | 86.39% | NA |
| Temperate Japonica | 767 | 69.50% | 0.10% | 0.13% | 30.25% | NA |
| Tropical Japonica | 504 | 48.40% | 0.00% | 0.60% | 50.99% | NA |
| Japonica Intermediate | 241 | 80.10% | 0.00% | 0.41% | 19.50% | NA |
| VI/Aromatic | 96 | 7.30% | 2.10% | 5.21% | 85.42% | NA |
| Intermediate | 90 | 31.10% | 2.20% | 0.00% | 66.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405892464 | T -> DEL | LOC_Os04g10860.1 | N | frameshift_variant | Average:9.143; most accessible tissue: Callus, score: 23.501 | N | N | N | N |
| vg0405892464 | T -> A | LOC_Os04g10860.1 | missense_variant ; p.Phe447Tyr; MODERATE | nonsynonymous_codon ; F447Y | Average:9.143; most accessible tissue: Callus, score: 23.501 | benign |
-0.037 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405892464 | NA | 7.13E-08 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405892464 | 1.24E-06 | 1.04E-10 | mr1227 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405892464 | NA | 4.95E-06 | mr1227 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405892464 | NA | 4.65E-07 | mr1245 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405892464 | NA | 4.27E-09 | mr1275 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405892464 | NA | 2.13E-14 | mr1361 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405892464 | NA | 5.68E-06 | mr1373 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405892464 | NA | 9.96E-07 | mr1450 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405892464 | NA | 3.21E-06 | mr1574 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405892464 | NA | 9.00E-08 | mr1622 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405892464 | NA | 7.51E-08 | mr1677 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405892464 | NA | 8.45E-14 | mr1726 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405892464 | NA | 1.99E-09 | mr1866 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |