Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405856867:

Variant ID: vg0405856867 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5856867
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATTTTGATATGGGTTTGATAAATTTAACATACGTTTGACAAATTTCGATAATTTTGACACAAATTTGATATATTTTTGACAAAGTTAACTTACACTTCA[T/C]
AGATTTCATAAATTTTTGACAACATCAATCTCAAACTGTACATGTCCAAGAAAAACACAAACACATGTAGTTAATGTATCACCGCAGGCTTCCCTCGAAA

Reverse complement sequence

TTTCGAGGGAAGCCTGCGGTGATACATTAACTACATGTGTTTGTGTTTTTCTTGGACATGTACAGTTTGAGATTGATGTTGTCAAAAATTTATGAAATCT[A/G]
TGAAGTGTAAGTTAACTTTGTCAAAAATATATCAAATTTGTGTCAAAATTATCGAAATTTGTCAAACGTATGTTAAATTTATCAAACCCATATCAAAATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.20%	4.70%	0.34%	50.76%	NA
All Indica	2759	21.50%	4.70%	0.43%	73.40%	NA
All Japonica	1512	81.90%	4.00%	0.07%	14.02%	NA
Aus	269	62.10%	7.40%	0.37%	30.11%	NA
Indica I	595	21.30%	0.70%	0.17%	77.82%	NA
Indica II	465	18.30%	7.70%	0.65%	73.33%	NA
Indica III	913	18.00%	7.30%	0.33%	74.37%	NA
Indica Intermediate	786	27.50%	2.90%	0.64%	68.96%	NA
Temperate Japonica	767	75.10%	3.40%	0.13%	21.38%	NA
Tropical Japonica	504	87.30%	5.40%	0.00%	7.34%	NA
Japonica Intermediate	241	92.10%	3.30%	0.00%	4.56%	NA
VI/Aromatic	96	50.00%	2.10%	1.04%	46.88%	NA
Intermediate	90	51.10%	7.80%	1.11%	40.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405856867	T -> C	LOC_Os04g10770.1	upstream_gene_variant ; 1679.0bp to feature; MODIFIER	silent_mutation	Average:44.121; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg0405856867	T -> C	LOC_Os04g10780.1	upstream_gene_variant ; 1844.0bp to feature; MODIFIER	silent_mutation	Average:44.121; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg0405856867	T -> C	LOC_Os04g10790.1	downstream_gene_variant ; 4145.0bp to feature; MODIFIER	silent_mutation	Average:44.121; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg0405856867	T -> C	LOC_Os04g10770-LOC_Os04g10780	intergenic_region ; MODIFIER	silent_mutation	Average:44.121; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N
vg0405856867	T -> DEL	N	N	silent_mutation	Average:44.121; most accessible tissue: Minghui63 flag leaf, score: 59.244	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405856867	7.28E-06	1.17E-10	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405856867	3.13E-06	3.13E-06	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405856867	NA	2.61E-11	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405856867	NA	5.09E-06	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405856867	5.41E-08	6.99E-23	mr1062_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405856867	2.95E-09	2.08E-14	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405856867	2.22E-06	2.22E-06	mr1525_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405856867	NA	1.15E-07	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251