\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405832151:

Variant ID: vg0405832151 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5832151
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACTAGTCATAGCCCCCAAGCACCAGGAGTCGGCCTAGGCACTTCCCAAACATGCATACGAGTGATATGAGTTCGTCATTAATGGAACAAAGTTTCACGG[G/A]
TCAGAGTTTACTACTTGGGTACTTTTGCAATTATTAAGAGCAGAAAACAAATTTATTTTATCTCTATGCTTTTGATTTATTCTGAATAATACTTAGCACC

Reverse complement sequence

GGTGCTAAGTATTATTCAGAATAAATCAAAAGCATAGAGATAAAATAAATTTGTTTTCTGCTCTTAATAATTGCAAAAGTACCCAAGTAGTAAACTCTGA[C/T]
CCGTGAAACTTTGTTCCATTAATGACGAACTCATATCACTCGTATGCATGTTTGGGAAGTGCCTAGGCCGACTCCTGGTGCTTGGGGGCTATGACTAGTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.60% 5.30% 6.16% 54.95% NA
All Indica  2759 7.70% 6.00% 6.78% 79.56% NA
All Japonica  1512 80.40% 0.10% 0.20% 19.38% NA
Aus  269 9.70% 30.90% 34.20% 25.28% NA
Indica I  595 2.90% 2.40% 2.02% 92.77% NA
Indica II  465 11.00% 0.90% 9.89% 78.28% NA
Indica III  913 8.80% 13.10% 9.09% 69.00% NA
Indica Intermediate  786 8.10% 3.40% 5.85% 82.57% NA
Temperate Japonica  767 94.30% 0.10% 0.13% 5.48% NA
Tropical Japonica  504 56.50% 0.00% 0.20% 43.25% NA
Japonica Intermediate  241 85.90% 0.00% 0.41% 13.69% NA
VI/Aromatic  96 95.80% 1.00% 2.08% 1.04% NA
Intermediate  90 46.70% 1.10% 7.78% 44.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405832151 G -> DEL N N silent_mutation Average:9.385; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg0405832151 G -> A LOC_Os04g10720.1 upstream_gene_variant ; 4496.0bp to feature; MODIFIER silent_mutation Average:9.385; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg0405832151 G -> A LOC_Os04g10724.1 downstream_gene_variant ; 2438.0bp to feature; MODIFIER silent_mutation Average:9.385; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg0405832151 G -> A LOC_Os04g10740.1 downstream_gene_variant ; 3007.0bp to feature; MODIFIER silent_mutation Average:9.385; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg0405832151 G -> A LOC_Os04g10730.1 intron_variant ; MODIFIER silent_mutation Average:9.385; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405832151 NA 1.02E-06 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151 NA 5.08E-06 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151 NA 3.10E-10 mr1232 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151 NA 6.89E-06 mr1293 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151 NA 6.29E-06 mr1297 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151 NA 2.51E-06 mr1312 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151 NA 2.65E-06 mr1616 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151 NA 7.58E-07 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151 NA 3.12E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151 NA 3.04E-07 mr1687 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151 NA 3.37E-07 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151 NA 3.58E-07 mr1787 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151 NA 6.65E-10 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151 4.20E-07 1.03E-09 mr1963 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151 NA 7.59E-06 mr1963 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251