Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405832151:

Variant ID: vg0405832151 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5832151
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACTAGTCATAGCCCCCAAGCACCAGGAGTCGGCCTAGGCACTTCCCAAACATGCATACGAGTGATATGAGTTCGTCATTAATGGAACAAAGTTTCACGG[G/A]
TCAGAGTTTACTACTTGGGTACTTTTGCAATTATTAAGAGCAGAAAACAAATTTATTTTATCTCTATGCTTTTGATTTATTCTGAATAATACTTAGCACC

Reverse complement sequence

GGTGCTAAGTATTATTCAGAATAAATCAAAAGCATAGAGATAAAATAAATTTGTTTTCTGCTCTTAATAATTGCAAAAGTACCCAAGTAGTAAACTCTGA[C/T]
CCGTGAAACTTTGTTCCATTAATGACGAACTCATATCACTCGTATGCATGTTTGGGAAGTGCCTAGGCCGACTCCTGGTGCTTGGGGGCTATGACTAGTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.60%	5.30%	6.16%	54.95%	NA
All Indica	2759	7.70%	6.00%	6.78%	79.56%	NA
All Japonica	1512	80.40%	0.10%	0.20%	19.38%	NA
Aus	269	9.70%	30.90%	34.20%	25.28%	NA
Indica I	595	2.90%	2.40%	2.02%	92.77%	NA
Indica II	465	11.00%	0.90%	9.89%	78.28%	NA
Indica III	913	8.80%	13.10%	9.09%	69.00%	NA
Indica Intermediate	786	8.10%	3.40%	5.85%	82.57%	NA
Temperate Japonica	767	94.30%	0.10%	0.13%	5.48%	NA
Tropical Japonica	504	56.50%	0.00%	0.20%	43.25%	NA
Japonica Intermediate	241	85.90%	0.00%	0.41%	13.69%	NA
VI/Aromatic	96	95.80%	1.00%	2.08%	1.04%	NA
Intermediate	90	46.70%	1.10%	7.78%	44.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405832151	G -> DEL	N	N	silent_mutation	Average:9.385; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N
vg0405832151	G -> A	LOC_Os04g10720.1	upstream_gene_variant ; 4496.0bp to feature; MODIFIER	silent_mutation	Average:9.385; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N
vg0405832151	G -> A	LOC_Os04g10724.1	downstream_gene_variant ; 2438.0bp to feature; MODIFIER	silent_mutation	Average:9.385; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N
vg0405832151	G -> A	LOC_Os04g10740.1	downstream_gene_variant ; 3007.0bp to feature; MODIFIER	silent_mutation	Average:9.385; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N
vg0405832151	G -> A	LOC_Os04g10730.1	intron_variant ; MODIFIER	silent_mutation	Average:9.385; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405832151	NA	1.02E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151	NA	5.08E-06	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151	NA	3.10E-10	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151	NA	6.89E-06	mr1293	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151	NA	6.29E-06	mr1297	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151	NA	2.51E-06	mr1312	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151	NA	2.65E-06	mr1616	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151	NA	7.58E-07	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151	NA	3.12E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151	NA	3.04E-07	mr1687	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151	NA	3.37E-07	mr1777	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151	NA	3.58E-07	mr1787	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151	NA	6.65E-10	mr1939	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151	4.20E-07	1.03E-09	mr1963	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405832151	NA	7.59E-06	mr1963	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251