\
| Variant ID: vg0405832147 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5832147 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GCCCGACTAGTCATAGCCCCCAAGCACCAGGAGTCGGCCTAGGCACTTCCCAAACATGCATACGAGTGATATGAGTTCGTCATTAATGGAACAAAGTTTC[A/G]
CGGGTCAGAGTTTACTACTTGGGTACTTTTGCAATTATTAAGAGCAGAAAACAAATTTATTTTATCTCTATGCTTTTGATTTATTCTGAATAATACTTAG
CTAAGTATTATTCAGAATAAATCAAAAGCATAGAGATAAAATAAATTTGTTTTCTGCTCTTAATAATTGCAAAAGTACCCAAGTAGTAAACTCTGACCCG[T/C]
GAAACTTTGTTCCATTAATGACGAACTCATATCACTCGTATGCATGTTTGGGAAGTGCCTAGGCCGACTCCTGGTGCTTGGGGGCTATGACTAGTCGGGC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.70% | 6.10% | 4.97% | 55.21% | NA |
| All Indica | 2759 | 7.90% | 6.40% | 5.51% | 80.21% | NA |
| All Japonica | 1512 | 80.40% | 0.10% | 0.20% | 19.31% | NA |
| Aus | 269 | 9.70% | 40.50% | 26.02% | 23.79% | NA |
| Indica I | 595 | 2.90% | 2.90% | 1.51% | 92.77% | NA |
| Indica II | 465 | 11.00% | 1.70% | 6.88% | 80.43% | NA |
| Indica III | 913 | 9.00% | 13.50% | 7.45% | 70.10% | NA |
| Indica Intermediate | 786 | 8.50% | 3.70% | 5.47% | 82.32% | NA |
| Temperate Japonica | 767 | 94.30% | 0.10% | 0.13% | 5.48% | NA |
| Tropical Japonica | 504 | 56.50% | 0.00% | 0.20% | 43.25% | NA |
| Japonica Intermediate | 241 | 85.90% | 0.40% | 0.41% | 13.28% | NA |
| VI/Aromatic | 96 | 95.80% | 1.00% | 2.08% | 1.04% | NA |
| Intermediate | 90 | 46.70% | 1.10% | 8.89% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405832147 | A -> DEL | N | N | silent_mutation | Average:8.559; most accessible tissue: Minghui63 root, score: 13.235 | N | N | N | N |
| vg0405832147 | A -> G | LOC_Os04g10720.1 | upstream_gene_variant ; 4492.0bp to feature; MODIFIER | silent_mutation | Average:8.559; most accessible tissue: Minghui63 root, score: 13.235 | N | N | N | N |
| vg0405832147 | A -> G | LOC_Os04g10724.1 | downstream_gene_variant ; 2434.0bp to feature; MODIFIER | silent_mutation | Average:8.559; most accessible tissue: Minghui63 root, score: 13.235 | N | N | N | N |
| vg0405832147 | A -> G | LOC_Os04g10740.1 | downstream_gene_variant ; 3011.0bp to feature; MODIFIER | silent_mutation | Average:8.559; most accessible tissue: Minghui63 root, score: 13.235 | N | N | N | N |
| vg0405832147 | A -> G | LOC_Os04g10730.1 | intron_variant ; MODIFIER | silent_mutation | Average:8.559; most accessible tissue: Minghui63 root, score: 13.235 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405832147 | NA | 2.89E-06 | mr1054 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | NA | 2.46E-07 | mr1073 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | NA | 3.59E-07 | mr1209 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | NA | 7.45E-11 | mr1232 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | NA | 1.81E-06 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | NA | 5.33E-06 | mr1287 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | NA | 7.80E-06 | mr1293 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | NA | 2.33E-07 | mr1297 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | 1.73E-06 | 9.08E-08 | mr1312 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | NA | 3.10E-06 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | NA | 5.94E-06 | mr1372 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | NA | 3.99E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | NA | 1.78E-06 | mr1433 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | NA | 2.04E-07 | mr1434 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | NA | 1.44E-06 | mr1512 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | NA | 3.32E-07 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | NA | 7.96E-12 | mr1649 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | NA | 1.63E-06 | mr1665 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | NA | 1.93E-07 | mr1687 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | NA | 3.22E-08 | mr1777 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | NA | 1.02E-07 | mr1787 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | NA | 3.79E-10 | mr1939 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | 6.78E-07 | 1.42E-09 | mr1963 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405832147 | NA | 9.14E-06 | mr1963 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |