\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405831867:

Variant ID: vg0405831867 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5831867
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATAGGCGAGGACACCAGTCGGCGGCGACGGAAGCAGGCCAGTCGGTGATGTTCTGACTGATCCATTCCTGAAGCGTAGGAGATAAGCATAAAGCCATGA[A/C]
TCCCTATTATGCATATCTGGATCTGGATCCTGTGGAACAAACATATAGAATGAGTAGTATCTGATGTAATATAATACTCGAGAAAAATTCAAGTATTTTA

Reverse complement sequence

TAAAATACTTGAATTTTTCTCGAGTATTATATTACATCAGATACTACTCATTCTATATGTTTGTTCCACAGGATCCAGATCCAGATATGCATAATAGGGA[T/G]
TCATGGCTTTATGCTTATCTCCTACGCTTCAGGAATGGATCAGTCAGAACATCACCGACTGGCCTGCTTCCGTCGCCGCCGACTGGTGTCCTCGCCTATA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.40% 9.20% 14.83% 39.65% NA
All Indica  2759 11.60% 8.90% 22.58% 56.90% NA
All Japonica  1512 81.00% 0.10% 3.04% 15.87% NA
Aus  269 13.00% 67.30% 6.32% 13.38% NA
Indica I  595 4.40% 4.50% 10.59% 80.50% NA
Indica II  465 15.30% 3.20% 22.37% 59.14% NA
Indica III  913 14.00% 15.90% 29.90% 40.20% NA
Indica Intermediate  786 12.10% 7.50% 23.28% 57.12% NA
Temperate Japonica  767 94.50% 0.10% 0.78% 4.56% NA
Tropical Japonica  504 57.50% 0.00% 6.94% 35.52% NA
Japonica Intermediate  241 86.70% 0.40% 2.07% 10.79% NA
VI/Aromatic  96 97.90% 1.00% 0.00% 1.04% NA
Intermediate  90 50.00% 3.30% 16.67% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405831867 A -> C LOC_Os04g10730.1 missense_variant ; p.Asp66Glu; MODERATE nonsynonymous_codon ; D66E Average:17.592; most accessible tissue: Minghui63 root, score: 29.362 unknown unknown TOLERATED 1.00
vg0405831867 A -> DEL LOC_Os04g10730.1 N frameshift_variant Average:17.592; most accessible tissue: Minghui63 root, score: 29.362 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405831867 NA 4.72E-07 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405831867 NA 2.61E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405831867 NA 4.83E-08 mr1209 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405831867 NA 6.12E-07 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405831867 NA 6.01E-06 mr1293 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405831867 NA 2.66E-07 mr1297 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405831867 6.51E-07 5.73E-08 mr1312 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405831867 NA 1.24E-06 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405831867 NA 4.16E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405831867 NA 1.00E-06 mr1420 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405831867 NA 2.92E-06 mr1433 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405831867 NA 1.38E-06 mr1434 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405831867 NA 2.56E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405831867 NA 1.31E-07 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405831867 NA 3.21E-11 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405831867 NA 9.16E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405831867 NA 6.66E-07 mr1687 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405831867 NA 1.21E-07 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405831867 NA 1.52E-07 mr1787 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405831867 NA 2.04E-09 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405831867 NA 1.30E-07 mr1963 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251