\
| Variant ID: vg0405830585 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5830585 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 97. )
CTGATTAATTGATTGCTTCATCTTGACATAAAGCTTGTCGAATTTTGAGCCATGTATTTGTGTAGCTCCCGATTCTTTGGTTAGTTGGGAAACAACTGAA[C/T]
ATAGAGTCGAGAATTATAGCTTCTTGTCGTCAAGTAGTCATTGCTTGATTGAAGATATGTGTTGAAGATGATGACGCCCATTAGCAGCAGCAACGACGTG
CACGTCGTTGCTGCTGCTAATGGGCGTCATCATCTTCAACACATATCTTCAATCAAGCAATGACTACTTGACGACAAGAAGCTATAATTCTCGACTCTAT[G/A]
TTCAGTTGTTTCCCAACTAACCAAAGAATCGGGAGCTACACAAATACATGGCTCAAAATTCGACAAGCTTTATGTCAAGATGAAGCAATCAATTAATCAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.70% | 4.70% | 9.71% | 28.88% | NA |
| All Indica | 2759 | 30.60% | 7.90% | 15.73% | 45.74% | NA |
| All Japonica | 1512 | 98.00% | 0.00% | 0.00% | 1.98% | NA |
| Aus | 269 | 74.30% | 0.00% | 6.32% | 19.33% | NA |
| Indica I | 595 | 24.70% | 1.70% | 9.75% | 63.87% | NA |
| Indica II | 465 | 27.70% | 17.40% | 17.42% | 37.42% | NA |
| Indica III | 913 | 31.50% | 5.90% | 18.07% | 44.47% | NA |
| Indica Intermediate | 786 | 35.80% | 9.30% | 16.54% | 38.42% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 94.80% | 0.00% | 0.00% | 5.16% | NA |
| Japonica Intermediate | 241 | 98.80% | 0.00% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 66.70% | 3.30% | 7.78% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405830585 | C -> DEL | N | N | silent_mutation | Average:36.199; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| vg0405830585 | C -> T | LOC_Os04g10720.1 | upstream_gene_variant ; 2930.0bp to feature; MODIFIER | silent_mutation | Average:36.199; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| vg0405830585 | C -> T | LOC_Os04g10724.1 | downstream_gene_variant ; 872.0bp to feature; MODIFIER | silent_mutation | Average:36.199; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| vg0405830585 | C -> T | LOC_Os04g10730.1 | downstream_gene_variant ; 133.0bp to feature; MODIFIER | silent_mutation | Average:36.199; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| vg0405830585 | C -> T | LOC_Os04g10740.1 | downstream_gene_variant ; 4573.0bp to feature; MODIFIER | silent_mutation | Average:36.199; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| vg0405830585 | C -> T | LOC_Os04g10724-LOC_Os04g10730 | intergenic_region ; MODIFIER | silent_mutation | Average:36.199; most accessible tissue: Zhenshan97 young leaf, score: 47.986 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405830585 | NA | 5.29E-06 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405830585 | 3.49E-06 | 1.18E-06 | mr1460_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405830585 | 1.13E-07 | 3.31E-07 | mr1460_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405830585 | 3.93E-06 | NA | mr1612_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405830585 | 6.27E-06 | 2.92E-06 | mr1612_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405830585 | NA | 5.28E-06 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |