\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405830585:

Variant ID: vg0405830585 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5830585
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


CTGATTAATTGATTGCTTCATCTTGACATAAAGCTTGTCGAATTTTGAGCCATGTATTTGTGTAGCTCCCGATTCTTTGGTTAGTTGGGAAACAACTGAA[C/T]
ATAGAGTCGAGAATTATAGCTTCTTGTCGTCAAGTAGTCATTGCTTGATTGAAGATATGTGTTGAAGATGATGACGCCCATTAGCAGCAGCAACGACGTG

Reverse complement sequence

CACGTCGTTGCTGCTGCTAATGGGCGTCATCATCTTCAACACATATCTTCAATCAAGCAATGACTACTTGACGACAAGAAGCTATAATTCTCGACTCTAT[G/A]
TTCAGTTGTTTCCCAACTAACCAAAGAATCGGGAGCTACACAAATACATGGCTCAAAATTCGACAAGCTTTATGTCAAGATGAAGCAATCAATTAATCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.70% 4.70% 9.71% 28.88% NA
All Indica  2759 30.60% 7.90% 15.73% 45.74% NA
All Japonica  1512 98.00% 0.00% 0.00% 1.98% NA
Aus  269 74.30% 0.00% 6.32% 19.33% NA
Indica I  595 24.70% 1.70% 9.75% 63.87% NA
Indica II  465 27.70% 17.40% 17.42% 37.42% NA
Indica III  913 31.50% 5.90% 18.07% 44.47% NA
Indica Intermediate  786 35.80% 9.30% 16.54% 38.42% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 94.80% 0.00% 0.00% 5.16% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 97.90% 0.00% 1.04% 1.04% NA
Intermediate  90 66.70% 3.30% 7.78% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405830585 C -> DEL N N silent_mutation Average:36.199; most accessible tissue: Zhenshan97 young leaf, score: 47.986 N N N N
vg0405830585 C -> T LOC_Os04g10720.1 upstream_gene_variant ; 2930.0bp to feature; MODIFIER silent_mutation Average:36.199; most accessible tissue: Zhenshan97 young leaf, score: 47.986 N N N N
vg0405830585 C -> T LOC_Os04g10724.1 downstream_gene_variant ; 872.0bp to feature; MODIFIER silent_mutation Average:36.199; most accessible tissue: Zhenshan97 young leaf, score: 47.986 N N N N
vg0405830585 C -> T LOC_Os04g10730.1 downstream_gene_variant ; 133.0bp to feature; MODIFIER silent_mutation Average:36.199; most accessible tissue: Zhenshan97 young leaf, score: 47.986 N N N N
vg0405830585 C -> T LOC_Os04g10740.1 downstream_gene_variant ; 4573.0bp to feature; MODIFIER silent_mutation Average:36.199; most accessible tissue: Zhenshan97 young leaf, score: 47.986 N N N N
vg0405830585 C -> T LOC_Os04g10724-LOC_Os04g10730 intergenic_region ; MODIFIER silent_mutation Average:36.199; most accessible tissue: Zhenshan97 young leaf, score: 47.986 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405830585 NA 5.29E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405830585 3.49E-06 1.18E-06 mr1460_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405830585 1.13E-07 3.31E-07 mr1460_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405830585 3.93E-06 NA mr1612_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405830585 6.27E-06 2.92E-06 mr1612_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405830585 NA 5.28E-06 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251