\
| Variant ID: vg0405797011 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5797011 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.55, T: 0.44, others allele: 0.00, population size: 99. )
TGGCACTGATCGGTGCTTGATGAGGACATTAGTGCCGGCTTTAGTCGTTGTTGGCACCAAGGTAACGTGTGTTGCGGTCGTAGGGTGCTGGTGATGAAGA[A/T]
CACAGTACGGCGGCGGCGATGGGAATTGCCAAGATGGAGTTTGCCCTTCGATTCCCCTTAGCGCTCCTTAGGATCAGTAGAACTTAGGGTTTAGGATATC
GATATCCTAAACCCTAAGTTCTACTGATCCTAAGGAGCGCTAAGGGGAATCGAAGGGCAAACTCCATCTTGGCAATTCCCATCGCCGCCGCCGTACTGTG[T/A]
TCTTCATCACCAGCACCCTACGACCGCAACACACGTTACCTTGGTGCCAACAACGACTAAAGCCGGCACTAATGTCCTCATCAAGCACCGATCAGTGCCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.90% | 30.70% | 0.23% | 16.23% | NA |
| All Indica | 2759 | 81.70% | 8.90% | 0.14% | 9.31% | NA |
| All Japonica | 1512 | 2.60% | 77.50% | 0.33% | 19.58% | NA |
| Aus | 269 | 40.90% | 1.10% | 0.00% | 57.99% | NA |
| Indica I | 595 | 81.20% | 7.10% | 0.17% | 11.60% | NA |
| Indica II | 465 | 86.90% | 9.70% | 0.00% | 3.44% | NA |
| Indica III | 913 | 84.70% | 6.90% | 0.00% | 8.43% | NA |
| Indica Intermediate | 786 | 75.40% | 12.10% | 0.38% | 12.09% | NA |
| Temperate Japonica | 767 | 0.30% | 90.20% | 0.00% | 9.52% | NA |
| Tropical Japonica | 504 | 6.00% | 54.80% | 0.79% | 38.49% | NA |
| Japonica Intermediate | 241 | 2.90% | 84.60% | 0.41% | 12.03% | NA |
| VI/Aromatic | 96 | 52.10% | 1.00% | 0.00% | 46.88% | NA |
| Intermediate | 90 | 51.10% | 32.20% | 2.22% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405797011 | A -> DEL | N | N | silent_mutation | Average:42.513; most accessible tissue: Minghui63 young leaf, score: 75.006 | N | N | N | N |
| vg0405797011 | A -> T | LOC_Os04g10660-LOC_Os04g10680 | intergenic_region ; MODIFIER | silent_mutation | Average:42.513; most accessible tissue: Minghui63 young leaf, score: 75.006 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405797011 | NA | 1.01E-10 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0405797011 | NA | 2.08E-15 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405797011 | NA | 7.72E-15 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405797011 | NA | 1.97E-06 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405797011 | NA | 5.80E-06 | mr1134 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405797011 | 4.55E-06 | NA | mr1525 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405797011 | NA | 2.33E-13 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405797011 | NA | 3.06E-26 | mr1631 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405797011 | 4.53E-06 | 1.40E-07 | mr1682 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405797011 | NA | 1.47E-15 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405797011 | 2.20E-07 | 1.73E-07 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405797011 | 4.27E-07 | 3.09E-06 | mr1525_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |