\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405785336:

Variant ID: vg0405785336 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5785336
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGATCCATTCAGATGCCAATAAGCACCTAGTTGTTTAATCTTCCACTTCAGTCAAATAATCAGCTGATTTCCTTTATACTACCTCCATCCTAAAATGTTT[G/A]
ACGCCGTTGACTTTTTTAAAAATATTTAACCGTTCGTCTTATTCAAAAAATTTAAGTTATTGTTAATTCTTTTTCTATCATTTGATTTATTGTTAAATAT

Reverse complement sequence

ATATTTAACAATAAATCAAATGATAGAAAAAGAATTAACAATAACTTAAATTTTTTGAATAAGACGAACGGTTAAATATTTTTAAAAAAGTCAACGGCGT[C/T]
AAACATTTTAGGATGGAGGTAGTATAAAGGAAATCAGCTGATTATTTGACTGAAGTGGAAGATTAAACAACTAGGTGCTTATTGGCATCTGAATGGATCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 44.60% 38.80% 0.44% 16.23% NA
All Indica  2759 66.50% 23.60% 0.40% 9.50% NA
All Japonica  1512 16.10% 64.20% 0.20% 19.44% NA
Aus  269 0.70% 40.90% 1.49% 56.88% NA
Indica I  595 79.50% 8.70% 0.34% 11.43% NA
Indica II  465 44.10% 52.50% 0.00% 3.44% NA
Indica III  913 76.20% 14.60% 0.55% 8.65% NA
Indica Intermediate  786 58.80% 28.10% 0.51% 12.60% NA
Temperate Japonica  767 25.90% 65.20% 0.00% 8.87% NA
Tropical Japonica  504 5.00% 55.40% 0.40% 39.29% NA
Japonica Intermediate  241 8.30% 79.70% 0.41% 11.62% NA
VI/Aromatic  96 0.00% 52.10% 1.04% 46.88% NA
Intermediate  90 26.70% 56.70% 2.22% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405785336 G -> DEL N N silent_mutation Average:40.022; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0405785336 G -> A LOC_Os04g10640.1 downstream_gene_variant ; 2924.0bp to feature; MODIFIER silent_mutation Average:40.022; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0405785336 G -> A LOC_Os04g10650.1 downstream_gene_variant ; 242.0bp to feature; MODIFIER silent_mutation Average:40.022; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0405785336 G -> A LOC_Os04g10640-LOC_Os04g10650 intergenic_region ; MODIFIER silent_mutation Average:40.022; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405785336 1.72E-06 NA mr1035 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405785336 1.56E-08 6.35E-12 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405785336 NA 4.19E-10 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405785336 2.68E-07 2.68E-07 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405785336 NA 3.41E-06 mr1608 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405785336 2.65E-06 NA mr1626 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405785336 2.17E-09 1.66E-12 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405785336 2.60E-06 NA mr1631 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405785336 9.19E-09 9.19E-09 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405785336 5.40E-07 1.04E-09 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405785336 8.43E-07 NA mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405785336 1.70E-11 5.68E-17 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405785336 NA 5.89E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405785336 1.20E-08 1.20E-08 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405785336 7.59E-06 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405785336 1.60E-07 5.84E-12 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405785336 NA 2.26E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405785336 NA 9.55E-11 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251