\
| Variant ID: vg0405780712 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5780712 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 120. )
ATAAATCAAAGGGACCCTAAAGGATCCTTCATTCTACACATGCAGAAGAACATCTGATTTGAACAAGGCCCTCCAGGAATTGAAGGAGGGAAGTTCATTC[T/C]
GTTTTTAAAATGCCGTTTTTATCATTCAAATGAATATGAGCAACTGGAGCAACTAAATTATACCAATTAATTAAGTTTTGATCTATCAACACTCTTCGAA
TTCGAAGAGTGTTGATAGATCAAAACTTAATTAATTGGTATAATTTAGTTGCTCCAGTTGCTCATATTCATTTGAATGATAAAAACGGCATTTTAAAAAC[A/G]
GAATGAACTTCCCTCCTTCAATTCCTGGAGGGCCTTGTTCAAATCAGATGTTCTTCTGCATGTGTAGAATGAAGGATCCTTTAGGGTCCCTTTGATTTAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.90% | 26.00% | 1.95% | 0.08% | NA |
| All Indica | 2759 | 90.50% | 8.70% | 0.80% | 0.00% | NA |
| All Japonica | 1512 | 31.70% | 63.50% | 4.56% | 0.26% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 86.70% | 10.10% | 3.23% | 0.00% | NA |
| Indica III | 913 | 93.20% | 6.60% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 87.50% | 11.80% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 27.40% | 66.20% | 5.87% | 0.52% | NA |
| Tropical Japonica | 504 | 44.40% | 52.00% | 3.57% | 0.00% | NA |
| Japonica Intermediate | 241 | 18.70% | 78.80% | 2.49% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 30.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405780712 | T -> C | LOC_Os04g10640.1 | upstream_gene_variant ; 923.0bp to feature; MODIFIER | silent_mutation | Average:37.583; most accessible tissue: Callus, score: 55.386 | N | N | N | N |
| vg0405780712 | T -> C | LOC_Os04g10630.1 | downstream_gene_variant ; 1612.0bp to feature; MODIFIER | silent_mutation | Average:37.583; most accessible tissue: Callus, score: 55.386 | N | N | N | N |
| vg0405780712 | T -> C | LOC_Os04g10650.1 | downstream_gene_variant ; 4866.0bp to feature; MODIFIER | silent_mutation | Average:37.583; most accessible tissue: Callus, score: 55.386 | N | N | N | N |
| vg0405780712 | T -> C | LOC_Os04g10630-LOC_Os04g10640 | intergenic_region ; MODIFIER | silent_mutation | Average:37.583; most accessible tissue: Callus, score: 55.386 | N | N | N | N |
| vg0405780712 | T -> DEL | N | N | silent_mutation | Average:37.583; most accessible tissue: Callus, score: 55.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405780712 | NA | 2.66E-10 | Grain_weight | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0405780712 | 2.35E-13 | 4.90E-28 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | 8.35E-08 | 2.09E-10 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | 8.54E-14 | 1.55E-28 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | 1.06E-08 | 6.30E-12 | mr1062 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | NA | 2.88E-06 | mr1143 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | 1.57E-13 | 1.35E-08 | mr1525 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | 2.09E-09 | 2.09E-09 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | 3.75E-13 | 1.29E-25 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | 1.07E-08 | 4.93E-12 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | 1.84E-11 | 1.34E-35 | mr1631 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | 2.93E-08 | 2.93E-08 | mr1631 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | NA | 7.85E-06 | mr1675 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | 8.14E-06 | 8.14E-06 | mr1726 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | NA | 1.92E-06 | mr1995 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | 3.49E-15 | 1.42E-27 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | 1.29E-09 | 1.14E-12 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | 2.00E-13 | 3.56E-31 | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | 8.83E-06 | 9.57E-06 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | 4.91E-06 | 4.00E-09 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | 1.19E-07 | 1.22E-07 | mr1525_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | 2.44E-06 | 4.45E-06 | mr1525_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | 1.11E-07 | 1.11E-07 | mr1525_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | 1.90E-13 | 6.36E-42 | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405780712 | 1.36E-07 | 3.15E-11 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |