\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405780712:

Variant ID: vg0405780712 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5780712
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAATCAAAGGGACCCTAAAGGATCCTTCATTCTACACATGCAGAAGAACATCTGATTTGAACAAGGCCCTCCAGGAATTGAAGGAGGGAAGTTCATTC[T/C]
GTTTTTAAAATGCCGTTTTTATCATTCAAATGAATATGAGCAACTGGAGCAACTAAATTATACCAATTAATTAAGTTTTGATCTATCAACACTCTTCGAA

Reverse complement sequence

TTCGAAGAGTGTTGATAGATCAAAACTTAATTAATTGGTATAATTTAGTTGCTCCAGTTGCTCATATTCATTTGAATGATAAAAACGGCATTTTAAAAAC[A/G]
GAATGAACTTCCCTCCTTCAATTCCTGGAGGGCCTTGTTCAAATCAGATGTTCTTCTGCATGTGTAGAATGAAGGATCCTTTAGGGTCCCTTTGATTTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.90% 26.00% 1.95% 0.08% NA
All Indica  2759 90.50% 8.70% 0.80% 0.00% NA
All Japonica  1512 31.70% 63.50% 4.56% 0.26% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 93.10% 6.90% 0.00% 0.00% NA
Indica II  465 86.70% 10.10% 3.23% 0.00% NA
Indica III  913 93.20% 6.60% 0.22% 0.00% NA
Indica Intermediate  786 87.50% 11.80% 0.64% 0.00% NA
Temperate Japonica  767 27.40% 66.20% 5.87% 0.52% NA
Tropical Japonica  504 44.40% 52.00% 3.57% 0.00% NA
Japonica Intermediate  241 18.70% 78.80% 2.49% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 68.90% 30.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405780712 T -> C LOC_Os04g10640.1 upstream_gene_variant ; 923.0bp to feature; MODIFIER silent_mutation Average:37.583; most accessible tissue: Callus, score: 55.386 N N N N
vg0405780712 T -> C LOC_Os04g10630.1 downstream_gene_variant ; 1612.0bp to feature; MODIFIER silent_mutation Average:37.583; most accessible tissue: Callus, score: 55.386 N N N N
vg0405780712 T -> C LOC_Os04g10650.1 downstream_gene_variant ; 4866.0bp to feature; MODIFIER silent_mutation Average:37.583; most accessible tissue: Callus, score: 55.386 N N N N
vg0405780712 T -> C LOC_Os04g10630-LOC_Os04g10640 intergenic_region ; MODIFIER silent_mutation Average:37.583; most accessible tissue: Callus, score: 55.386 N N N N
vg0405780712 T -> DEL N N silent_mutation Average:37.583; most accessible tissue: Callus, score: 55.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405780712 NA 2.66E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0405780712 2.35E-13 4.90E-28 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 8.35E-08 2.09E-10 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 8.54E-14 1.55E-28 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 1.06E-08 6.30E-12 mr1062 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 NA 2.88E-06 mr1143 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 1.57E-13 1.35E-08 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 2.09E-09 2.09E-09 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 3.75E-13 1.29E-25 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 1.07E-08 4.93E-12 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 1.84E-11 1.34E-35 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 2.93E-08 2.93E-08 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 NA 7.85E-06 mr1675 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 8.14E-06 8.14E-06 mr1726 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 NA 1.92E-06 mr1995 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 3.49E-15 1.42E-27 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 1.29E-09 1.14E-12 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 2.00E-13 3.56E-31 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 8.83E-06 9.57E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 4.91E-06 4.00E-09 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 1.19E-07 1.22E-07 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 2.44E-06 4.45E-06 mr1525_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 1.11E-07 1.11E-07 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 1.90E-13 6.36E-42 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405780712 1.36E-07 3.15E-11 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251