\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405774987:

Variant ID: vg0405774987 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5774987
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCTCATCTAATGAGAAGCACCCAAATCCTTTAGGACAATTGCGTTCATGCCCTTACTTTCAATAGCAATTATGATTTTACCCCTATTTTTTAGGGTTTG[C/T]
GATTTTACCCTAGTTCTTTTGAAAATACAGCAACATGTTACCCCTGATTTGGATGGTCAGTTTGACGGTGTTAAATCAGTGATGAAAAGATATATTTACC

Reverse complement sequence

GGTAAATATATCTTTTCATCACTGATTTAACACCGTCAAACTGACCATCCAAATCAGGGGTAACATGTTGCTGTATTTTCAAAAGAACTAGGGTAAAATC[G/A]
CAAACCCTAAAAAATAGGGGTAAAATCATAATTGCTATTGAAAGTAAGGGCATGAACGCAATTGTCCTAAAGGATTTGGGTGCTTCTCATTAGATGAGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.70% 2.80% 0.55% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 89.60% 8.70% 1.72% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 81.40% 15.50% 3.13% 0.00% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 0.80% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405774987 C -> T LOC_Os04g10630.1 upstream_gene_variant ; 646.0bp to feature; MODIFIER silent_mutation Average:62.363; most accessible tissue: Callus, score: 90.504 N N N N
vg0405774987 C -> T LOC_Os04g10620-LOC_Os04g10630 intergenic_region ; MODIFIER silent_mutation Average:62.363; most accessible tissue: Callus, score: 90.504 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405774987 2.63E-06 8.53E-07 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405774987 8.47E-07 4.56E-11 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405774987 6.72E-08 6.72E-08 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405774987 3.76E-06 1.85E-06 mr1626 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405774987 6.63E-06 4.97E-09 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405774987 4.58E-06 3.13E-08 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251