\
| Variant ID: vg0405774987 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5774987 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCCTCATCTAATGAGAAGCACCCAAATCCTTTAGGACAATTGCGTTCATGCCCTTACTTTCAATAGCAATTATGATTTTACCCCTATTTTTTAGGGTTTG[C/T]
GATTTTACCCTAGTTCTTTTGAAAATACAGCAACATGTTACCCCTGATTTGGATGGTCAGTTTGACGGTGTTAAATCAGTGATGAAAAGATATATTTACC
GGTAAATATATCTTTTCATCACTGATTTAACACCGTCAAACTGACCATCCAAATCAGGGGTAACATGTTGCTGTATTTTCAAAAGAACTAGGGTAAAATC[G/A]
CAAACCCTAAAAAATAGGGGTAAAATCATAATTGCTATTGAAAGTAAGGGCATGAACGCAATTGTCCTAAAGGATTTGGGTGCTTCTCATTAGATGAGGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.70% | 2.80% | 0.55% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 89.60% | 8.70% | 1.72% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 81.40% | 15.50% | 3.13% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 0.80% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405774987 | C -> T | LOC_Os04g10630.1 | upstream_gene_variant ; 646.0bp to feature; MODIFIER | silent_mutation | Average:62.363; most accessible tissue: Callus, score: 90.504 | N | N | N | N |
| vg0405774987 | C -> T | LOC_Os04g10620-LOC_Os04g10630 | intergenic_region ; MODIFIER | silent_mutation | Average:62.363; most accessible tissue: Callus, score: 90.504 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405774987 | 2.63E-06 | 8.53E-07 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405774987 | 8.47E-07 | 4.56E-11 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405774987 | 6.72E-08 | 6.72E-08 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405774987 | 3.76E-06 | 1.85E-06 | mr1626 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405774987 | 6.63E-06 | 4.97E-09 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405774987 | 4.58E-06 | 3.13E-08 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |