\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405742124:

Variant ID: vg0405742124 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5742124
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTAATCTTACATTGAGGTCCTTTAATCTGTTTTTGTAAAATAAAATCAAAAAAAAAAGAAAGAAAAAAAAGGCAGAATGGTGCATAAAAAAAGAAGAAAA[G/C]
AAAAGCCGCACCCAAAAAAAAAAGAAAAGAAAAGGAAAGGAAAAAAAAGAAAGAAGAAAGAAAGAAAAGAGAAAATATTGTTATGTTTGAGCTGAACTCA

Reverse complement sequence

TGAGTTCAGCTCAAACATAACAATATTTTCTCTTTTCTTTCTTTCTTCTTTCTTTTTTTTCCTTTCCTTTTCTTTTCTTTTTTTTTTGGGTGCGGCTTTT[C/G]
TTTTCTTCTTTTTTTATGCACCATTCTGCCTTTTTTTTCTTTCTTTTTTTTTTGATTTTATTTTACAAAAACAGATTAAAGGACCTCAATGTAAGATTAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.70% 2.80% 2.81% 2.67% NA
All Indica  2759 99.00% 0.40% 0.62% 0.00% NA
All Japonica  1512 76.50% 7.80% 7.41% 8.33% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.20% 0.43% 0.00% NA
Indica III  913 97.70% 0.80% 1.53% 0.00% NA
Indica Intermediate  786 99.50% 0.40% 0.13% 0.00% NA
Temperate Japonica  767 73.10% 7.70% 4.17% 14.99% NA
Tropical Japonica  504 74.00% 9.70% 14.68% 1.59% NA
Japonica Intermediate  241 92.10% 4.10% 2.49% 1.24% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 94.40% 1.10% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405742124 G -> C LOC_Os04g10590.1 upstream_gene_variant ; 520.0bp to feature; MODIFIER silent_mutation Average:23.889; most accessible tissue: Minghui63 flag leaf, score: 47.544 N N N N
vg0405742124 G -> C LOC_Os04g10569.1 downstream_gene_variant ; 1031.0bp to feature; MODIFIER silent_mutation Average:23.889; most accessible tissue: Minghui63 flag leaf, score: 47.544 N N N N
vg0405742124 G -> C LOC_Os04g10569-LOC_Os04g10590 intergenic_region ; MODIFIER silent_mutation Average:23.889; most accessible tissue: Minghui63 flag leaf, score: 47.544 N N N N
vg0405742124 G -> DEL N N silent_mutation Average:23.889; most accessible tissue: Minghui63 flag leaf, score: 47.544 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405742124 NA 8.42E-06 mr1702 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405742124 3.85E-06 3.85E-06 mr1193_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405742124 NA 9.25E-07 mr1298_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405742124 NA 9.36E-06 mr1318_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405742124 8.37E-06 8.37E-06 mr1440_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405742124 NA 6.43E-07 mr1510_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405742124 NA 2.64E-06 mr1638_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405742124 4.40E-06 4.40E-06 mr1641_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405742124 NA 3.77E-06 mr1702_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405742124 NA 9.13E-06 mr1729_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405742124 NA 8.46E-07 mr1731_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405742124 NA 4.86E-06 mr1741_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405742124 NA 8.41E-07 mr1788_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405742124 NA 8.29E-06 mr1976_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251