\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405737766:

Variant ID: vg0405737766 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5737766
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.10, others allele: 0.00, population size: 82. )

Flanking Sequence (100 bp) in Reference Genome:


AACTTTTTTTAAAAAATAACACCTACAATATATTATAGGTACCGGTTAATTAAAAAAGGTACTGTTAACGATCCTTAAATCATAATATCTGACCGTCAAT[G/A]
TCTACATATAATAATATAAAATATGATATCCAACTTAGTAGTAGGGATTATTACTAATTATTTCCACTAGTGTTGGTGAAATATGAGTATGCAGGTATTT

Reverse complement sequence

AAATACCTGCATACTCATATTTCACCAACACTAGTGGAAATAATTAGTAATAATCCCTACTACTAAGTTGGATATCATATTTTATATTATTATATGTAGA[C/T]
ATTGACGGTCAGATATTATGATTTAAGGATCGTTAACAGTACCTTTTTTAATTAACCGGTACCTATAATATATTGTAGGTGTTATTTTTTAAAAAAAGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.20% 14.80% 0.59% 14.39% NA
All Indica  2759 79.20% 13.30% 0.43% 7.03% NA
All Japonica  1512 68.80% 11.80% 0.66% 18.72% NA
Aus  269 10.40% 32.30% 1.49% 55.76% NA
Indica I  595 89.10% 1.00% 0.50% 9.41% NA
Indica II  465 59.10% 38.30% 0.22% 2.37% NA
Indica III  913 84.90% 7.10% 0.11% 7.89% NA
Indica Intermediate  786 77.10% 15.00% 0.89% 7.00% NA
Temperate Japonica  767 70.10% 20.30% 0.13% 9.39% NA
Tropical Japonica  504 59.10% 2.60% 1.39% 36.90% NA
Japonica Intermediate  241 85.10% 3.70% 0.83% 10.37% NA
VI/Aromatic  96 7.30% 46.90% 1.04% 44.79% NA
Intermediate  90 63.30% 24.40% 1.11% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405737766 G -> DEL N N silent_mutation Average:35.309; most accessible tissue: Callus, score: 88.908 N N N N
vg0405737766 G -> A LOC_Os04g10569.1 upstream_gene_variant ; 1674.0bp to feature; MODIFIER silent_mutation Average:35.309; most accessible tissue: Callus, score: 88.908 N N N N
vg0405737766 G -> A LOC_Os04g10590.1 upstream_gene_variant ; 4878.0bp to feature; MODIFIER silent_mutation Average:35.309; most accessible tissue: Callus, score: 88.908 N N N N
vg0405737766 G -> A LOC_Os04g10550.1 downstream_gene_variant ; 703.0bp to feature; MODIFIER silent_mutation Average:35.309; most accessible tissue: Callus, score: 88.908 N N N N
vg0405737766 G -> A LOC_Os04g10550-LOC_Os04g10569 intergenic_region ; MODIFIER silent_mutation Average:35.309; most accessible tissue: Callus, score: 88.908 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405737766 5.53E-09 3.25E-13 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 NA 3.06E-06 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 1.27E-07 9.61E-09 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 NA 7.45E-09 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 2.46E-15 9.49E-23 mr1062 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 2.71E-07 5.75E-11 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 8.26E-09 9.06E-14 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 NA 5.39E-11 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 NA 7.22E-10 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 4.13E-12 2.94E-13 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 6.94E-06 7.09E-07 mr1525 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 2.04E-07 2.04E-07 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 NA 3.22E-09 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 2.01E-08 7.71E-13 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 NA 1.14E-06 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 4.73E-07 2.86E-08 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 NA 7.54E-10 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 NA 3.48E-09 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 NA 9.14E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 NA 6.15E-10 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 NA 4.92E-11 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 8.41E-09 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 1.66E-06 1.43E-07 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 4.18E-19 1.99E-30 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 3.97E-10 1.07E-19 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 7.80E-13 3.96E-18 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 NA 3.02E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 NA 4.64E-06 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 NA 1.60E-08 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 NA 3.83E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 1.95E-11 1.96E-11 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 1.35E-06 1.95E-08 mr1525_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 1.40E-07 1.40E-07 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 4.16E-10 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 3.36E-09 5.10E-12 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 NA 1.08E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 NA 5.55E-11 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 NA 8.42E-08 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405737766 NA 7.90E-08 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251