\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405735471:

Variant ID: vg0405735471 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5735471
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


ATGGATCTTAAGAATTATAAATATTAATAAATCGCTTGTTTACGAGAAATGACTAGTATCATATTTAAATGGATGATAAGTAGAATTACTTATCATTATT[C/T]
TGTGTGCCAAGATGAAATATAACTATATCAAAAGTAGATGGAGGGAGTATTACTTCTAAAGAAAATCGAGCGCGTACGTCAGGTGGCGCCATGCCACACG

Reverse complement sequence

CGTGTGGCATGGCGCCACCTGACGTACGCGCTCGATTTTCTTTAGAAGTAATACTCCCTCCATCTACTTTTGATATAGTTATATTTCATCTTGGCACACA[G/A]
AATAATGATAAGTAATTCTACTTATCATCCATTTAAATATGATACTAGTCATTTCTCGTAAACAAGCGATTTATTAATATTTATAATTCTTAAGATCCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.20% 13.30% 1.93% 0.61% NA
All Indica  2759 86.40% 12.60% 0.91% 0.04% NA
All Japonica  1512 82.20% 11.70% 4.23% 1.85% NA
Aus  269 68.80% 31.20% 0.00% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 58.10% 38.10% 3.87% 0.00% NA
Indica III  913 93.20% 6.50% 0.22% 0.11% NA
Indica Intermediate  786 85.80% 13.60% 0.64% 0.00% NA
Temperate Japonica  767 72.10% 20.30% 4.30% 3.26% NA
Tropical Japonica  504 92.50% 2.60% 4.56% 0.40% NA
Japonica Intermediate  241 92.90% 3.30% 3.32% 0.41% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 81.10% 16.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405735471 C -> DEL N N silent_mutation Average:59.794; most accessible tissue: Minghui63 root, score: 88.035 N N N N
vg0405735471 C -> T LOC_Os04g10550.1 upstream_gene_variant ; 1284.0bp to feature; MODIFIER silent_mutation Average:59.794; most accessible tissue: Minghui63 root, score: 88.035 N N N N
vg0405735471 C -> T LOC_Os04g10569.1 upstream_gene_variant ; 3969.0bp to feature; MODIFIER silent_mutation Average:59.794; most accessible tissue: Minghui63 root, score: 88.035 N N N N
vg0405735471 C -> T LOC_Os04g10530.1 downstream_gene_variant ; 3519.0bp to feature; MODIFIER silent_mutation Average:59.794; most accessible tissue: Minghui63 root, score: 88.035 N N N N
vg0405735471 C -> T LOC_Os04g10530-LOC_Os04g10550 intergenic_region ; MODIFIER silent_mutation Average:59.794; most accessible tissue: Minghui63 root, score: 88.035 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405735471 6.76E-11 2.23E-14 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 NA 2.08E-06 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 1.27E-07 9.61E-09 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 NA 1.52E-08 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 6.34E-15 6.73E-23 mr1062 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 5.90E-07 1.35E-10 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 8.26E-09 9.06E-14 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 NA 3.36E-11 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 NA 1.25E-09 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 2.67E-12 7.16E-14 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 NA 1.83E-06 mr1525 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 2.04E-07 2.04E-07 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 NA 2.34E-09 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 2.03E-10 3.26E-14 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 NA 9.58E-07 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 4.73E-07 2.86E-08 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 9.01E-06 NA mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 NA 1.14E-09 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 NA 1.40E-08 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 NA 9.50E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 NA 5.39E-10 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 NA 6.46E-11 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 1.35E-08 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 1.66E-06 1.43E-07 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 1.67E-20 1.80E-32 mr1062_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 1.71E-10 5.73E-20 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 7.80E-13 3.96E-18 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 NA 3.13E-08 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 NA 6.07E-10 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 2.94E-13 2.94E-13 mr1525_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 2.24E-06 3.24E-08 mr1525_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 1.40E-07 1.40E-07 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 9.99E-10 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 3.36E-09 5.10E-12 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 NA 7.71E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 NA 5.15E-08 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405735471 NA 6.03E-08 mr1846_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251