\
| Variant ID: vg0405727925 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 5727925 |
| Reference Allele: T | Alternative Allele: A,TTTA |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 85. )
TTGGCTTTTTAAAAACATCTTGGGGAGGCAAGCCACTGGCCATTTGCGAAAATATGTTTTTGACCATTTCTGTAGTAGTGATTATACTGCACTTGCATTT[T/A,TTTA]
AAAATTTTTCATCTATAAAAAATACCGAATATCGAAAAGCTACTTGGTTTTCTTCGAGCAAAGAGAAGAGAACATTTATGCGACAATTAATAATGGAGAA
TTCTCCATTATTAATTGTCGCATAAATGTTCTCTTCTCTTTGCTCGAAGAAAACCAAGTAGCTTTTCGATATTCGGTATTTTTTATAGATGAAAAATTTT[A/T,TAAA]
AAATGCAAGTGCAGTATAATCACTACTACAGAAATGGTCAAAAACATATTTTCGCAAATGGCCAGTGGCTTGCCTCCCCAAGATGTTTTTAAAAAGCCAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.00% | 37.90% | 1.23% | 0.00% | TTTA: 6.92% |
| All Indica | 2759 | 65.10% | 23.00% | 0.14% | 0.00% | TTTA: 11.74% |
| All Japonica | 1512 | 32.80% | 64.00% | 3.04% | 0.00% | TTTA: 0.13% |
| Aus | 269 | 61.00% | 37.20% | 1.86% | 0.00% | NA |
| Indica I | 595 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 44.90% | 51.00% | 0.00% | 0.00% | TTTA: 4.09% |
| Indica III | 913 | 56.30% | 16.90% | 0.33% | 0.00% | TTTA: 26.51% |
| Indica Intermediate | 786 | 65.90% | 26.00% | 0.13% | 0.00% | TTTA: 8.02% |
| Temperate Japonica | 767 | 29.60% | 66.40% | 3.78% | 0.00% | TTTA: 0.26% |
| Tropical Japonica | 504 | 45.00% | 53.40% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 17.40% | 78.80% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 53.10% | 46.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 47.80% | 47.80% | 3.33% | 0.00% | TTTA: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405727925 | T -> A | LOC_Os04g10530.1 | upstream_gene_variant ; 74.0bp to feature; MODIFIER | silent_mutation | Average:75.871; most accessible tissue: Callus, score: 97.545 | N | N | N | N |
| vg0405727925 | T -> A | LOC_Os04g10500-LOC_Os04g10530 | intergenic_region ; MODIFIER | silent_mutation | Average:75.871; most accessible tissue: Callus, score: 97.545 | N | N | N | N |
| vg0405727925 | T -> TTTA | LOC_Os04g10530.1 | upstream_gene_variant ; 73.0bp to feature; MODIFIER | silent_mutation | Average:75.871; most accessible tissue: Callus, score: 97.545 | N | N | N | N |
| vg0405727925 | T -> TTTA | LOC_Os04g10500-LOC_Os04g10530 | intergenic_region ; MODIFIER | silent_mutation | Average:75.871; most accessible tissue: Callus, score: 97.545 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405727925 | 1.01E-08 | 4.78E-11 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 9.45E-09 | mr1059 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | 9.91E-09 | 1.17E-10 | mr1062 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 1.19E-16 | mr1143 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 5.73E-11 | mr1143 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 9.04E-09 | mr1167 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | 3.94E-09 | 3.94E-09 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 1.84E-14 | mr1535 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 1.19E-08 | mr1535 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | 1.38E-08 | 1.64E-11 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | 9.30E-07 | 9.29E-07 | mr1631 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 6.35E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 4.98E-15 | mr1675 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 4.77E-09 | mr1675 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 1.55E-16 | mr1726 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 9.69E-10 | mr1726 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 1.06E-06 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 8.85E-18 | mr1995 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 1.99E-10 | mr1995 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | 1.59E-10 | 1.68E-13 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 9.61E-08 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 3.04E-07 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | 2.38E-08 | 1.62E-10 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 5.22E-08 | mr1077_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 4.82E-07 | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 6.25E-09 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 4.87E-06 | mr1204_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 3.92E-06 | mr1204_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 5.94E-06 | mr1277_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 3.60E-06 | mr1296_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 1.11E-07 | mr1441_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 1.96E-07 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | 6.40E-10 | 6.40E-10 | mr1525_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 5.81E-06 | mr1566_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 6.62E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | 1.26E-08 | 1.24E-12 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 9.29E-06 | mr1726_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 1.97E-07 | mr1830_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405727925 | NA | 5.95E-08 | mr1837_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |