\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405727925:

Variant ID: vg0405727925 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 5727925
Reference Allele: TAlternative Allele: A,TTTA
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


TTGGCTTTTTAAAAACATCTTGGGGAGGCAAGCCACTGGCCATTTGCGAAAATATGTTTTTGACCATTTCTGTAGTAGTGATTATACTGCACTTGCATTT[T/A,TTTA]
AAAATTTTTCATCTATAAAAAATACCGAATATCGAAAAGCTACTTGGTTTTCTTCGAGCAAAGAGAAGAGAACATTTATGCGACAATTAATAATGGAGAA

Reverse complement sequence

TTCTCCATTATTAATTGTCGCATAAATGTTCTCTTCTCTTTGCTCGAAGAAAACCAAGTAGCTTTTCGATATTCGGTATTTTTTATAGATGAAAAATTTT[A/T,TAAA]
AAATGCAAGTGCAGTATAATCACTACTACAGAAATGGTCAAAAACATATTTTCGCAAATGGCCAGTGGCTTGCCTCCCCAAGATGTTTTTAAAAAGCCAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.00% 37.90% 1.23% 0.00% TTTA: 6.92%
All Indica  2759 65.10% 23.00% 0.14% 0.00% TTTA: 11.74%
All Japonica  1512 32.80% 64.00% 3.04% 0.00% TTTA: 0.13%
Aus  269 61.00% 37.20% 1.86% 0.00% NA
Indica I  595 93.30% 6.70% 0.00% 0.00% NA
Indica II  465 44.90% 51.00% 0.00% 0.00% TTTA: 4.09%
Indica III  913 56.30% 16.90% 0.33% 0.00% TTTA: 26.51%
Indica Intermediate  786 65.90% 26.00% 0.13% 0.00% TTTA: 8.02%
Temperate Japonica  767 29.60% 66.40% 3.78% 0.00% TTTA: 0.26%
Tropical Japonica  504 45.00% 53.40% 1.59% 0.00% NA
Japonica Intermediate  241 17.40% 78.80% 3.73% 0.00% NA
VI/Aromatic  96 53.10% 46.90% 0.00% 0.00% NA
Intermediate  90 47.80% 47.80% 3.33% 0.00% TTTA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405727925 T -> A LOC_Os04g10530.1 upstream_gene_variant ; 74.0bp to feature; MODIFIER silent_mutation Average:75.871; most accessible tissue: Callus, score: 97.545 N N N N
vg0405727925 T -> A LOC_Os04g10500-LOC_Os04g10530 intergenic_region ; MODIFIER silent_mutation Average:75.871; most accessible tissue: Callus, score: 97.545 N N N N
vg0405727925 T -> TTTA LOC_Os04g10530.1 upstream_gene_variant ; 73.0bp to feature; MODIFIER silent_mutation Average:75.871; most accessible tissue: Callus, score: 97.545 N N N N
vg0405727925 T -> TTTA LOC_Os04g10500-LOC_Os04g10530 intergenic_region ; MODIFIER silent_mutation Average:75.871; most accessible tissue: Callus, score: 97.545 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405727925 1.01E-08 4.78E-11 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 9.45E-09 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 9.91E-09 1.17E-10 mr1062 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 1.19E-16 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 5.73E-11 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 9.04E-09 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 3.94E-09 3.94E-09 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 1.84E-14 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 1.19E-08 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 1.38E-08 1.64E-11 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 9.30E-07 9.29E-07 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 6.35E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 4.98E-15 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 4.77E-09 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 1.55E-16 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 9.69E-10 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 1.06E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 8.85E-18 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 1.99E-10 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 1.59E-10 1.68E-13 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 9.61E-08 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 3.04E-07 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 2.38E-08 1.62E-10 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 5.22E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 4.82E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 6.25E-09 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 4.87E-06 mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 3.92E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 5.94E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 3.60E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 1.11E-07 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 1.96E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 6.40E-10 6.40E-10 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 5.81E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 6.62E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 1.26E-08 1.24E-12 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 9.29E-06 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 1.97E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727925 NA 5.95E-08 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251