Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405727386:

Variant ID: vg0405727386 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5727386
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.08, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

GGTAATATTGACGGTCGAAACTGGTCGATAATGACCGTCAACAATCACTTCCCATTCCTAGTGCGTAGATCATCCGGTGGTGGCCACTAGAGCGCGGACC[C/T]
GCCGCTGTTGGGCACGGGAGCAGTACAGACGACCACGGTGACCTCTGGAGCGTGAATCCCTCATCGCTCGGGAAGGAGCGACGACGGCAACAGCCGCGGC

Reverse complement sequence

GCCGCGGCTGTTGCCGTCGTCGCTCCTTCCCGAGCGATGAGGGATTCACGCTCCAGAGGTCACCGTGGTCGTCTGTACTGCTCCCGTGCCCAACAGCGGC[G/A]
GGTCCGCGCTCTAGTGGCCACCACCGGATGATCTACGCACTAGGAATGGGAAGTGATTGTTGACGGTCATTATCGACCAGTTTCGACCGTCAATATTACC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.20%	45.70%	0.02%	0.00%	NA
All Indica	2759	76.30%	23.70%	0.04%	0.00%	NA
All Japonica	1512	4.10%	95.90%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	94.10%	5.90%	0.00%	0.00%	NA
Indica II	465	77.80%	21.90%	0.22%	0.00%	NA
Indica III	913	61.90%	38.10%	0.00%	0.00%	NA
Indica Intermediate	786	78.60%	21.40%	0.00%	0.00%	NA
Temperate Japonica	767	3.80%	96.20%	0.00%	0.00%	NA
Tropical Japonica	504	2.80%	97.20%	0.00%	0.00%	NA
Japonica Intermediate	241	7.90%	92.10%	0.00%	0.00%	NA
VI/Aromatic	96	87.50%	12.50%	0.00%	0.00%	NA
Intermediate	90	50.00%	50.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405727386	C -> T	LOC_Os04g10530.1	upstream_gene_variant ; 613.0bp to feature; MODIFIER	silent_mutation	Average:57.943; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N
vg0405727386	C -> T	LOC_Os04g10500-LOC_Os04g10530	intergenic_region ; MODIFIER	silent_mutation	Average:57.943; most accessible tissue: Zhenshan97 young leaf, score: 77.736	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405727386	9.14E-06	9.72E-18	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727386	1.31E-08	8.88E-10	mr1035	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727386	NA	2.93E-15	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727386	NA	8.71E-07	mr1525	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727386	NA	6.23E-15	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727386	6.30E-07	1.30E-07	mr1626	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727386	5.92E-07	3.06E-31	mr1631	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727386	1.36E-06	5.61E-07	mr1631	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727386	NA	1.95E-15	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727386	NA	1.70E-19	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727386	2.99E-07	4.68E-07	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727386	2.67E-08	1.10E-09	mr1525_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727386	NA	4.69E-34	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405727386	NA	7.71E-06	mr1631_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251