\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405725035:

Variant ID: vg0405725035 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5725035
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATCCTAGCCGTTGGATCTGGCCAATCCAACGGCTGGTAGAGTTTGGTACCGGGCAGTACCAATTCTATCCCTGGTGCAGTGCCACGTGAAGAACTGAGG[T/C]
GGAAGGGCTAAAACGTAACTTCGCGTGCAGTGAGAACAGACTGTAGCCCTAGAAATCCCGATCCGCCGCCACCGTGTTCCTCTTCCGCGCCACTGCTGTG

Reverse complement sequence

CACAGCAGTGGCGCGGAAGAGGAACACGGTGGCGGCGGATCGGGATTTCTAGGGCTACAGTCTGTTCTCACTGCACGCGAAGTTACGTTTTAGCCCTTCC[A/G]
CCTCAGTTCTTCACGTGGCACTGCACCAGGGATAGAATTGGTACTGCCCGGTACCAAACTCTACCAGCCGTTGGATTGGCCAGATCCAACGGCTAGGATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.00% 2.30% 2.09% 18.64% NA
All Indica  2759 72.70% 0.20% 1.45% 25.66% NA
All Japonica  1512 88.80% 6.70% 2.18% 2.25% NA
Aus  269 62.50% 0.00% 7.81% 29.74% NA
Indica I  595 98.50% 0.00% 0.17% 1.34% NA
Indica II  465 56.80% 0.20% 3.01% 40.00% NA
Indica III  913 60.70% 0.10% 1.53% 37.68% NA
Indica Intermediate  786 76.60% 0.40% 1.40% 21.63% NA
Temperate Japonica  767 94.30% 1.30% 1.56% 2.87% NA
Tropical Japonica  504 86.90% 9.90% 2.78% 0.40% NA
Japonica Intermediate  241 75.50% 17.40% 2.90% 4.15% NA
VI/Aromatic  96 54.20% 0.00% 2.08% 43.75% NA
Intermediate  90 75.60% 2.20% 3.33% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405725035 T -> C LOC_Os04g10530.1 upstream_gene_variant ; 2964.0bp to feature; MODIFIER silent_mutation Average:73.903; most accessible tissue: Zhenshan97 young leaf, score: 86.542 N N N N
vg0405725035 T -> C LOC_Os04g10500-LOC_Os04g10530 intergenic_region ; MODIFIER silent_mutation Average:73.903; most accessible tissue: Zhenshan97 young leaf, score: 86.542 N N N N
vg0405725035 T -> DEL N N silent_mutation Average:73.903; most accessible tissue: Zhenshan97 young leaf, score: 86.542 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405725035 2.76E-06 2.76E-06 mr1085 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405725035 NA 4.16E-06 mr1086 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405725035 NA 8.96E-06 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405725035 NA 1.93E-08 mr1104 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405725035 NA 7.81E-06 mr1139 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405725035 5.13E-06 1.00E-07 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405725035 NA 6.36E-10 mr1213 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405725035 NA 6.36E-08 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405725035 NA 1.28E-07 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405725035 6.92E-06 2.97E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405725035 NA 2.88E-06 mr1246 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405725035 NA 7.65E-07 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405725035 NA 1.23E-08 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405725035 NA 1.53E-07 mr1437 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405725035 NA 9.18E-09 mr1620 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405725035 NA 4.70E-06 mr1878 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405725035 NA 7.76E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405725035 NA 6.13E-06 mr1228_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251