\
| Variant ID: vg0405725035 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5725035 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AATCCTAGCCGTTGGATCTGGCCAATCCAACGGCTGGTAGAGTTTGGTACCGGGCAGTACCAATTCTATCCCTGGTGCAGTGCCACGTGAAGAACTGAGG[T/C]
GGAAGGGCTAAAACGTAACTTCGCGTGCAGTGAGAACAGACTGTAGCCCTAGAAATCCCGATCCGCCGCCACCGTGTTCCTCTTCCGCGCCACTGCTGTG
CACAGCAGTGGCGCGGAAGAGGAACACGGTGGCGGCGGATCGGGATTTCTAGGGCTACAGTCTGTTCTCACTGCACGCGAAGTTACGTTTTAGCCCTTCC[A/G]
CCTCAGTTCTTCACGTGGCACTGCACCAGGGATAGAATTGGTACTGCCCGGTACCAAACTCTACCAGCCGTTGGATTGGCCAGATCCAACGGCTAGGATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.00% | 2.30% | 2.09% | 18.64% | NA |
| All Indica | 2759 | 72.70% | 0.20% | 1.45% | 25.66% | NA |
| All Japonica | 1512 | 88.80% | 6.70% | 2.18% | 2.25% | NA |
| Aus | 269 | 62.50% | 0.00% | 7.81% | 29.74% | NA |
| Indica I | 595 | 98.50% | 0.00% | 0.17% | 1.34% | NA |
| Indica II | 465 | 56.80% | 0.20% | 3.01% | 40.00% | NA |
| Indica III | 913 | 60.70% | 0.10% | 1.53% | 37.68% | NA |
| Indica Intermediate | 786 | 76.60% | 0.40% | 1.40% | 21.63% | NA |
| Temperate Japonica | 767 | 94.30% | 1.30% | 1.56% | 2.87% | NA |
| Tropical Japonica | 504 | 86.90% | 9.90% | 2.78% | 0.40% | NA |
| Japonica Intermediate | 241 | 75.50% | 17.40% | 2.90% | 4.15% | NA |
| VI/Aromatic | 96 | 54.20% | 0.00% | 2.08% | 43.75% | NA |
| Intermediate | 90 | 75.60% | 2.20% | 3.33% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405725035 | T -> C | LOC_Os04g10530.1 | upstream_gene_variant ; 2964.0bp to feature; MODIFIER | silent_mutation | Average:73.903; most accessible tissue: Zhenshan97 young leaf, score: 86.542 | N | N | N | N |
| vg0405725035 | T -> C | LOC_Os04g10500-LOC_Os04g10530 | intergenic_region ; MODIFIER | silent_mutation | Average:73.903; most accessible tissue: Zhenshan97 young leaf, score: 86.542 | N | N | N | N |
| vg0405725035 | T -> DEL | N | N | silent_mutation | Average:73.903; most accessible tissue: Zhenshan97 young leaf, score: 86.542 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405725035 | 2.76E-06 | 2.76E-06 | mr1085 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405725035 | NA | 4.16E-06 | mr1086 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405725035 | NA | 8.96E-06 | mr1088 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405725035 | NA | 1.93E-08 | mr1104 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405725035 | NA | 7.81E-06 | mr1139 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405725035 | 5.13E-06 | 1.00E-07 | mr1155 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405725035 | NA | 6.36E-10 | mr1213 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405725035 | NA | 6.36E-08 | mr1224 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405725035 | NA | 1.28E-07 | mr1225 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405725035 | 6.92E-06 | 2.97E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405725035 | NA | 2.88E-06 | mr1246 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405725035 | NA | 7.65E-07 | mr1404 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405725035 | NA | 1.23E-08 | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405725035 | NA | 1.53E-07 | mr1437 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405725035 | NA | 9.18E-09 | mr1620 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405725035 | NA | 4.70E-06 | mr1878 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405725035 | NA | 7.76E-06 | mr1104_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405725035 | NA | 6.13E-06 | mr1228_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |