\
| Variant ID: vg0405719474 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5719474 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
CAGGAAACGATGAGATTGGGGATTTTAGAATATTTGCACGGTGACTCCGAGATAACTTAAAACAAACACGAGCTCTCTGATGGTTTTAGGAATTTTTCTC[T/C]
GTGATATCTTGGATTTGGCTTGGAGAGGAAGCTAAAAGAAATTATGTGGAAGGTGGAAACTCAGAGGGAACAAAAGGAATATTGTTGACGAAAAATCCGC
GCGGATTTTTCGTCAACAATATTCCTTTTGTTCCCTCTGAGTTTCCACCTTCCACATAATTTCTTTTAGCTTCCTCTCCAAGCCAAATCCAAGATATCAC[A/G]
GAGAAAAATTCCTAAAACCATCAGAGAGCTCGTGTTTGTTTTAAGTTATCTCGGAGTCACCGTGCAAATATTCTAAAATCCCCAATCTCATCGTTTCCTG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.10% | 8.50% | 0.76% | 40.61% | NA |
| All Indica | 2759 | 37.70% | 0.40% | 1.12% | 60.82% | NA |
| All Japonica | 1512 | 73.30% | 24.60% | 0.13% | 1.92% | NA |
| Aus | 269 | 41.60% | 0.00% | 0.74% | 57.62% | NA |
| Indica I | 595 | 9.40% | 0.00% | 1.68% | 88.91% | NA |
| Indica II | 465 | 57.00% | 0.60% | 0.65% | 41.72% | NA |
| Indica III | 913 | 46.30% | 0.40% | 0.99% | 52.25% | NA |
| Indica Intermediate | 786 | 37.70% | 0.40% | 1.15% | 60.81% | NA |
| Temperate Japonica | 767 | 77.80% | 21.90% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 59.90% | 35.30% | 0.20% | 4.56% | NA |
| Japonica Intermediate | 241 | 87.10% | 10.80% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 53.10% | 12.50% | 0.00% | 34.38% | NA |
| Intermediate | 90 | 61.10% | 11.10% | 1.11% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405719474 | T -> C | LOC_Os04g10500-LOC_Os04g10530 | intergenic_region ; MODIFIER | silent_mutation | Average:50.367; most accessible tissue: Callus, score: 91.094 | N | N | N | N |
| vg0405719474 | T -> DEL | N | N | silent_mutation | Average:50.367; most accessible tissue: Callus, score: 91.094 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405719474 | 2.98E-06 | 8.54E-07 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405719474 | 1.60E-11 | NA | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405719474 | 7.26E-09 | 4.81E-11 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405719474 | 3.59E-11 | 2.69E-10 | mr1525 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405719474 | 1.26E-08 | 1.26E-08 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405719474 | NA | 5.10E-07 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405719474 | 2.34E-09 | NA | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405719474 | 4.55E-09 | 3.65E-10 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405719474 | 1.51E-10 | NA | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405719474 | 2.93E-07 | 2.32E-09 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405719474 | 1.31E-11 | 1.31E-11 | mr1525_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405719474 | 2.75E-08 | 2.75E-08 | mr1525_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405719474 | 5.94E-09 | NA | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405719474 | 3.92E-09 | 6.41E-11 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |