Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405717712:

Variant ID: vg0405717712 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5717712
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATGGACTCTAGTCTCCTCTTCTAATATTCCTTATTTTTTAATTCTGAATTTCAGCTATTTCTAAATTGTATTTCTATATGGATTCTGCCTTTTCTTTTT[C/T]
TCCGATTAATGTGAGAATTTTTAGGTCATGAGAGCGAACGTGGAGGCTCTTTTTTCTATTCCTTTAATAATATAATAGATACTACAAATATACGATAAAA

Reverse complement sequence

TTTTATCGTATATTTGTAGTATCTATTATATTATTAAAGGAATAGAAAAAAGAGCCTCCACGTTCGCTCTCATGACCTAAAAATTCTCACATTAATCGGA[G/A]
AAAAAGAAAAGGCAGAATCCATATAGAAATACAATTTAGAAATAGCTGAAATTCAGAATTAAAAAATAAGGAATATTAGAAGAGGAGACTAGAGTCCATA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	33.10%	3.60%	7.17%	56.18%	NA
All Indica	2759	12.20%	0.00%	10.37%	77.42%	NA
All Japonica	1512	77.10%	11.00%	1.46%	10.45%	NA
Aus	269	4.50%	0.00%	5.20%	90.33%	NA
Indica I	595	10.40%	0.00%	15.97%	73.61%	NA
Indica II	465	13.80%	0.00%	8.39%	77.85%	NA
Indica III	913	8.70%	0.00%	10.08%	81.27%	NA
Indica Intermediate	786	16.80%	0.00%	7.63%	75.57%	NA
Temperate Japonica	767	68.40%	19.30%	1.69%	10.56%	NA
Tropical Japonica	504	86.10%	2.40%	1.19%	10.32%	NA
Japonica Intermediate	241	85.90%	2.50%	1.24%	10.37%	NA
VI/Aromatic	96	16.70%	0.00%	10.42%	72.92%	NA
Intermediate	90	36.70%	2.20%	7.78%	53.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405717712	C -> DEL	N	N	silent_mutation	Average:22.216; most accessible tissue: Callus, score: 43.964	N	N	N	N
vg0405717712	C -> T	LOC_Os04g10500-LOC_Os04g10530	intergenic_region ; MODIFIER	silent_mutation	Average:22.216; most accessible tissue: Callus, score: 43.964	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405717712	8.15E-07	3.12E-08	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712	7.50E-09	NA	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712	3.08E-08	2.01E-12	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712	4.81E-07	8.70E-08	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712	9.66E-07	9.66E-07	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712	5.57E-06	1.61E-07	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712	6.38E-06	NA	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712	7.91E-06	4.51E-07	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712	6.14E-13	NA	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712	4.14E-13	9.17E-18	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712	4.62E-07	4.61E-07	mr1525_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712	2.98E-07	2.98E-07	mr1525_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712	1.63E-09	NA	mr1631_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712	1.10E-07	1.42E-10	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251