\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405717712:

Variant ID: vg0405717712 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5717712
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATGGACTCTAGTCTCCTCTTCTAATATTCCTTATTTTTTAATTCTGAATTTCAGCTATTTCTAAATTGTATTTCTATATGGATTCTGCCTTTTCTTTTT[C/T]
TCCGATTAATGTGAGAATTTTTAGGTCATGAGAGCGAACGTGGAGGCTCTTTTTTCTATTCCTTTAATAATATAATAGATACTACAAATATACGATAAAA

Reverse complement sequence

TTTTATCGTATATTTGTAGTATCTATTATATTATTAAAGGAATAGAAAAAAGAGCCTCCACGTTCGCTCTCATGACCTAAAAATTCTCACATTAATCGGA[G/A]
AAAAAGAAAAGGCAGAATCCATATAGAAATACAATTTAGAAATAGCTGAAATTCAGAATTAAAAAATAAGGAATATTAGAAGAGGAGACTAGAGTCCATA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.10% 3.60% 7.17% 56.18% NA
All Indica  2759 12.20% 0.00% 10.37% 77.42% NA
All Japonica  1512 77.10% 11.00% 1.46% 10.45% NA
Aus  269 4.50% 0.00% 5.20% 90.33% NA
Indica I  595 10.40% 0.00% 15.97% 73.61% NA
Indica II  465 13.80% 0.00% 8.39% 77.85% NA
Indica III  913 8.70% 0.00% 10.08% 81.27% NA
Indica Intermediate  786 16.80% 0.00% 7.63% 75.57% NA
Temperate Japonica  767 68.40% 19.30% 1.69% 10.56% NA
Tropical Japonica  504 86.10% 2.40% 1.19% 10.32% NA
Japonica Intermediate  241 85.90% 2.50% 1.24% 10.37% NA
VI/Aromatic  96 16.70% 0.00% 10.42% 72.92% NA
Intermediate  90 36.70% 2.20% 7.78% 53.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405717712 C -> DEL N N silent_mutation Average:22.216; most accessible tissue: Callus, score: 43.964 N N N N
vg0405717712 C -> T LOC_Os04g10500-LOC_Os04g10530 intergenic_region ; MODIFIER silent_mutation Average:22.216; most accessible tissue: Callus, score: 43.964 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405717712 8.15E-07 3.12E-08 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712 7.50E-09 NA mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712 3.08E-08 2.01E-12 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712 4.81E-07 8.70E-08 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712 9.66E-07 9.66E-07 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712 5.57E-06 1.61E-07 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712 6.38E-06 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712 7.91E-06 4.51E-07 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712 6.14E-13 NA mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712 4.14E-13 9.17E-18 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712 4.62E-07 4.61E-07 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712 2.98E-07 2.98E-07 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712 1.63E-09 NA mr1631_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405717712 1.10E-07 1.42E-10 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251