\
| Variant ID: vg0405706633 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5706633 |
| Reference Allele: G | Alternative Allele: A,T |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGTAACCTCCTAAAGTAAAATTGTGTGGTTCAGGATCACACAAACATTTTCTCATGATTAACATTTTTCTTTTGACTTTCATGATGGGTTTGTGAGTTTT[G/A,T]
TTAATGTTGCATACAAATACAATGTATAGTTGTGAAATATTAAATTCAAATTGTACAACATTCATAATGTATATTTGTGTGCGGGTATGTACGAATATAC
GTATATTCGTACATACCCGCACACAAATATACATTATGAATGTTGTACAATTTGAATTTAATATTTCACAACTATACATTGTATTTGTATGCAACATTAA[C/T,A]
AAAACTCACAAACCCATCATGAAAGTCAAAAGAAAAATGTTAATCATGAGAAAATGTTTGTGTGATCCTGAACCACACAATTTTACTTTAGGAGGTTACC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.80% | 1.80% | 1.10% | 40.20% | T: 0.11% |
| All Indica | 2759 | 38.50% | 0.10% | 1.01% | 60.42% | NA |
| All Japonica | 1512 | 91.80% | 5.20% | 1.32% | 1.72% | NA |
| Aus | 269 | 42.40% | 0.00% | 1.12% | 56.51% | NA |
| Indica I | 595 | 8.90% | 0.00% | 0.84% | 90.25% | NA |
| Indica II | 465 | 58.10% | 0.20% | 1.51% | 40.22% | NA |
| Indica III | 913 | 47.40% | 0.10% | 0.77% | 51.70% | NA |
| Indica Intermediate | 786 | 38.80% | 0.10% | 1.15% | 59.92% | NA |
| Temperate Japonica | 767 | 98.20% | 1.30% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 87.30% | 6.90% | 1.59% | 4.17% | NA |
| Japonica Intermediate | 241 | 80.90% | 13.70% | 3.32% | 2.07% | NA |
| VI/Aromatic | 96 | 66.70% | 0.00% | 0.00% | 31.25% | T: 2.08% |
| Intermediate | 90 | 65.60% | 2.20% | 1.11% | 27.78% | T: 3.33% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405706633 | G -> DEL | N | N | silent_mutation | Average:21.681; most accessible tissue: Zhenshan97 young leaf, score: 38.499 | N | N | N | N |
| vg0405706633 | G -> A | LOC_Os04g10490.1 | downstream_gene_variant ; 1474.0bp to feature; MODIFIER | silent_mutation | Average:21.681; most accessible tissue: Zhenshan97 young leaf, score: 38.499 | N | N | N | N |
| vg0405706633 | G -> A | LOC_Os04g10500.1 | intron_variant ; MODIFIER | silent_mutation | Average:21.681; most accessible tissue: Zhenshan97 young leaf, score: 38.499 | N | N | N | N |
| vg0405706633 | G -> T | LOC_Os04g10490.1 | downstream_gene_variant ; 1474.0bp to feature; MODIFIER | silent_mutation | Average:21.681; most accessible tissue: Zhenshan97 young leaf, score: 38.499 | N | N | N | N |
| vg0405706633 | G -> T | LOC_Os04g10500.1 | intron_variant ; MODIFIER | silent_mutation | Average:21.681; most accessible tissue: Zhenshan97 young leaf, score: 38.499 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405706633 | 1.17E-06 | 1.17E-06 | mr1085 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405706633 | NA | 4.81E-06 | mr1088 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405706633 | NA | 3.72E-07 | mr1104 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405706633 | 7.29E-06 | 2.13E-07 | mr1155 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405706633 | NA | 2.01E-08 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405706633 | NA | 1.92E-06 | mr1224 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405706633 | NA | 9.38E-07 | mr1225 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405706633 | NA | 2.07E-06 | mr1246 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405706633 | NA | 3.54E-06 | mr1404 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405706633 | NA | 6.63E-07 | mr1411 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405706633 | NA | 3.78E-06 | mr1437 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405706633 | NA | 1.12E-06 | mr1620 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |