\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405706633:

Variant ID: vg0405706633 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5706633
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTAACCTCCTAAAGTAAAATTGTGTGGTTCAGGATCACACAAACATTTTCTCATGATTAACATTTTTCTTTTGACTTTCATGATGGGTTTGTGAGTTTT[G/A,T]
TTAATGTTGCATACAAATACAATGTATAGTTGTGAAATATTAAATTCAAATTGTACAACATTCATAATGTATATTTGTGTGCGGGTATGTACGAATATAC

Reverse complement sequence

GTATATTCGTACATACCCGCACACAAATATACATTATGAATGTTGTACAATTTGAATTTAATATTTCACAACTATACATTGTATTTGTATGCAACATTAA[C/T,A]
AAAACTCACAAACCCATCATGAAAGTCAAAAGAAAAATGTTAATCATGAGAAAATGTTTGTGTGATCCTGAACCACACAATTTTACTTTAGGAGGTTACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.80% 1.80% 1.10% 40.20% T: 0.11%
All Indica  2759 38.50% 0.10% 1.01% 60.42% NA
All Japonica  1512 91.80% 5.20% 1.32% 1.72% NA
Aus  269 42.40% 0.00% 1.12% 56.51% NA
Indica I  595 8.90% 0.00% 0.84% 90.25% NA
Indica II  465 58.10% 0.20% 1.51% 40.22% NA
Indica III  913 47.40% 0.10% 0.77% 51.70% NA
Indica Intermediate  786 38.80% 0.10% 1.15% 59.92% NA
Temperate Japonica  767 98.20% 1.30% 0.52% 0.00% NA
Tropical Japonica  504 87.30% 6.90% 1.59% 4.17% NA
Japonica Intermediate  241 80.90% 13.70% 3.32% 2.07% NA
VI/Aromatic  96 66.70% 0.00% 0.00% 31.25% T: 2.08%
Intermediate  90 65.60% 2.20% 1.11% 27.78% T: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405706633 G -> DEL N N silent_mutation Average:21.681; most accessible tissue: Zhenshan97 young leaf, score: 38.499 N N N N
vg0405706633 G -> A LOC_Os04g10490.1 downstream_gene_variant ; 1474.0bp to feature; MODIFIER silent_mutation Average:21.681; most accessible tissue: Zhenshan97 young leaf, score: 38.499 N N N N
vg0405706633 G -> A LOC_Os04g10500.1 intron_variant ; MODIFIER silent_mutation Average:21.681; most accessible tissue: Zhenshan97 young leaf, score: 38.499 N N N N
vg0405706633 G -> T LOC_Os04g10490.1 downstream_gene_variant ; 1474.0bp to feature; MODIFIER silent_mutation Average:21.681; most accessible tissue: Zhenshan97 young leaf, score: 38.499 N N N N
vg0405706633 G -> T LOC_Os04g10500.1 intron_variant ; MODIFIER silent_mutation Average:21.681; most accessible tissue: Zhenshan97 young leaf, score: 38.499 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405706633 1.17E-06 1.17E-06 mr1085 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405706633 NA 4.81E-06 mr1088 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405706633 NA 3.72E-07 mr1104 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405706633 7.29E-06 2.13E-07 mr1155 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405706633 NA 2.01E-08 mr1213 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405706633 NA 1.92E-06 mr1224 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405706633 NA 9.38E-07 mr1225 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405706633 NA 2.07E-06 mr1246 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405706633 NA 3.54E-06 mr1404 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405706633 NA 6.63E-07 mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405706633 NA 3.78E-06 mr1437 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405706633 NA 1.12E-06 mr1620 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251