\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405694545:

Variant ID: vg0405694545 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5694545
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAGCATTTTTCTCAACGTGGGGGTCTTTTTTTCGCAGACGGACATGACTCTTAGAGCAAAATGACCGTCTACAAAAATATAAATCGGGGTGAAGTTCG[C/T]
TCTCCGCCTGTTTTCGCAGGTGGACAACTTAAGCGGCGCCTGGAAAAATATGATTTTTGCAGGCGAACCTTTTGTGGTCCGCCTGCAAAAGTCCGCCTGC

Reverse complement sequence

GCAGGCGGACTTTTGCAGGCGGACCACAAAAGGTTCGCCTGCAAAAATCATATTTTTCCAGGCGCCGCTTAAGTTGTCCACCTGCGAAAACAGGCGGAGA[G/A]
CGAACTTCACCCCGATTTATATTTTTGTAGACGGTCATTTTGCTCTAAGAGTCATGTCCGTCTGCGAAAAAAAGACCCCCACGTTGAGAAAAATGCTTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.40% 14.90% 1.04% 47.69% NA
All Indica  2759 8.60% 18.70% 0.91% 71.73% NA
All Japonica  1512 94.40% 0.40% 0.20% 5.03% NA
Aus  269 2.20% 39.40% 7.43% 50.93% NA
Indica I  595 6.40% 1.70% 1.18% 90.76% NA
Indica II  465 11.80% 41.10% 0.65% 46.45% NA
Indica III  913 5.60% 18.30% 0.77% 75.36% NA
Indica Intermediate  786 12.00% 19.00% 1.02% 68.07% NA
Temperate Japonica  767 95.70% 0.10% 0.13% 4.04% NA
Tropical Japonica  504 93.50% 0.20% 0.40% 5.95% NA
Japonica Intermediate  241 92.10% 1.70% 0.00% 6.22% NA
VI/Aromatic  96 13.50% 51.00% 0.00% 35.42% NA
Intermediate  90 41.10% 26.70% 1.11% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405694545 C -> DEL N N silent_mutation Average:37.624; most accessible tissue: Zhenshan97 young leaf, score: 62.534 N N N N
vg0405694545 C -> T LOC_Os04g10470.1 upstream_gene_variant ; 3488.0bp to feature; MODIFIER silent_mutation Average:37.624; most accessible tissue: Zhenshan97 young leaf, score: 62.534 N N N N
vg0405694545 C -> T LOC_Os04g10470-LOC_Os04g10480 intergenic_region ; MODIFIER silent_mutation Average:37.624; most accessible tissue: Zhenshan97 young leaf, score: 62.534 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405694545 NA 1.36E-16 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405694545 1.19E-06 8.37E-09 mr1035 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405694545 NA 9.85E-07 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405694545 NA 1.08E-13 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405694545 NA 8.52E-07 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405694545 NA 1.24E-06 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405694545 NA 1.55E-20 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251