Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405694545:

Variant ID: vg0405694545 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5694545
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAGCATTTTTCTCAACGTGGGGGTCTTTTTTTCGCAGACGGACATGACTCTTAGAGCAAAATGACCGTCTACAAAAATATAAATCGGGGTGAAGTTCG[C/T]
TCTCCGCCTGTTTTCGCAGGTGGACAACTTAAGCGGCGCCTGGAAAAATATGATTTTTGCAGGCGAACCTTTTGTGGTCCGCCTGCAAAAGTCCGCCTGC

Reverse complement sequence

GCAGGCGGACTTTTGCAGGCGGACCACAAAAGGTTCGCCTGCAAAAATCATATTTTTCCAGGCGCCGCTTAAGTTGTCCACCTGCGAAAACAGGCGGAGA[G/A]
CGAACTTCACCCCGATTTATATTTTTGTAGACGGTCATTTTGCTCTAAGAGTCATGTCCGTCTGCGAAAAAAAGACCCCCACGTTGAGAAAAATGCTTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.40%	14.90%	1.04%	47.69%	NA
All Indica	2759	8.60%	18.70%	0.91%	71.73%	NA
All Japonica	1512	94.40%	0.40%	0.20%	5.03%	NA
Aus	269	2.20%	39.40%	7.43%	50.93%	NA
Indica I	595	6.40%	1.70%	1.18%	90.76%	NA
Indica II	465	11.80%	41.10%	0.65%	46.45%	NA
Indica III	913	5.60%	18.30%	0.77%	75.36%	NA
Indica Intermediate	786	12.00%	19.00%	1.02%	68.07%	NA
Temperate Japonica	767	95.70%	0.10%	0.13%	4.04%	NA
Tropical Japonica	504	93.50%	0.20%	0.40%	5.95%	NA
Japonica Intermediate	241	92.10%	1.70%	0.00%	6.22%	NA
VI/Aromatic	96	13.50%	51.00%	0.00%	35.42%	NA
Intermediate	90	41.10%	26.70%	1.11%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405694545	C -> DEL	N	N	silent_mutation	Average:37.624; most accessible tissue: Zhenshan97 young leaf, score: 62.534	N	N	N	N
vg0405694545	C -> T	LOC_Os04g10470.1	upstream_gene_variant ; 3488.0bp to feature; MODIFIER	silent_mutation	Average:37.624; most accessible tissue: Zhenshan97 young leaf, score: 62.534	N	N	N	N
vg0405694545	C -> T	LOC_Os04g10470-LOC_Os04g10480	intergenic_region ; MODIFIER	silent_mutation	Average:37.624; most accessible tissue: Zhenshan97 young leaf, score: 62.534	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405694545	NA	1.36E-16	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405694545	1.19E-06	8.37E-09	mr1035	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405694545	NA	9.85E-07	mr1291	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405694545	NA	1.08E-13	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405694545	NA	8.52E-07	mr1626	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405694545	NA	1.24E-06	mr1631	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405694545	NA	1.55E-20	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251