\
| Variant ID: vg0405694545 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5694545 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 94. )
AAAAGCATTTTTCTCAACGTGGGGGTCTTTTTTTCGCAGACGGACATGACTCTTAGAGCAAAATGACCGTCTACAAAAATATAAATCGGGGTGAAGTTCG[C/T]
TCTCCGCCTGTTTTCGCAGGTGGACAACTTAAGCGGCGCCTGGAAAAATATGATTTTTGCAGGCGAACCTTTTGTGGTCCGCCTGCAAAAGTCCGCCTGC
GCAGGCGGACTTTTGCAGGCGGACCACAAAAGGTTCGCCTGCAAAAATCATATTTTTCCAGGCGCCGCTTAAGTTGTCCACCTGCGAAAACAGGCGGAGA[G/A]
CGAACTTCACCCCGATTTATATTTTTGTAGACGGTCATTTTGCTCTAAGAGTCATGTCCGTCTGCGAAAAAAAGACCCCCACGTTGAGAAAAATGCTTTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.40% | 14.90% | 1.04% | 47.69% | NA |
| All Indica | 2759 | 8.60% | 18.70% | 0.91% | 71.73% | NA |
| All Japonica | 1512 | 94.40% | 0.40% | 0.20% | 5.03% | NA |
| Aus | 269 | 2.20% | 39.40% | 7.43% | 50.93% | NA |
| Indica I | 595 | 6.40% | 1.70% | 1.18% | 90.76% | NA |
| Indica II | 465 | 11.80% | 41.10% | 0.65% | 46.45% | NA |
| Indica III | 913 | 5.60% | 18.30% | 0.77% | 75.36% | NA |
| Indica Intermediate | 786 | 12.00% | 19.00% | 1.02% | 68.07% | NA |
| Temperate Japonica | 767 | 95.70% | 0.10% | 0.13% | 4.04% | NA |
| Tropical Japonica | 504 | 93.50% | 0.20% | 0.40% | 5.95% | NA |
| Japonica Intermediate | 241 | 92.10% | 1.70% | 0.00% | 6.22% | NA |
| VI/Aromatic | 96 | 13.50% | 51.00% | 0.00% | 35.42% | NA |
| Intermediate | 90 | 41.10% | 26.70% | 1.11% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405694545 | C -> DEL | N | N | silent_mutation | Average:37.624; most accessible tissue: Zhenshan97 young leaf, score: 62.534 | N | N | N | N |
| vg0405694545 | C -> T | LOC_Os04g10470.1 | upstream_gene_variant ; 3488.0bp to feature; MODIFIER | silent_mutation | Average:37.624; most accessible tissue: Zhenshan97 young leaf, score: 62.534 | N | N | N | N |
| vg0405694545 | C -> T | LOC_Os04g10470-LOC_Os04g10480 | intergenic_region ; MODIFIER | silent_mutation | Average:37.624; most accessible tissue: Zhenshan97 young leaf, score: 62.534 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405694545 | NA | 1.36E-16 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405694545 | 1.19E-06 | 8.37E-09 | mr1035 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405694545 | NA | 9.85E-07 | mr1291 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405694545 | NA | 1.08E-13 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405694545 | NA | 8.52E-07 | mr1626 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405694545 | NA | 1.24E-06 | mr1631 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405694545 | NA | 1.55E-20 | mr1715_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |