\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405677437:

Variant ID: vg0405677437 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5677437
Reference Allele: GAlternative Allele: C,A
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAAAGAGAGAGAGGAGAGAGGAGGAAAGGGAGGAGGAAAAGATGAGGACAGGGTTTACGAGGAGGAGGAGAGGATAAGTGCGAGGGATTATATACGACGC[G/C,A]
TCGATCTTTAGTTCCGGTTGCTAACAGACAGGGGCCTGACACTTTTTGAATTGGGACTAAAATTGATCTTTGCTCCTGGTTGGTGTTACCAACCGGGACT

Reverse complement sequence

AGTCCCGGTTGGTAACACCAACCAGGAGCAAAGATCAATTTTAGTCCCAATTCAAAAAGTGTCAGGCCCCTGTCTGTTAGCAACCGGAACTAAAGATCGA[C/G,T]
GCGTCGTATATAATCCCTCGCACTTATCCTCTCCTCCTCCTCGTAAACCCTGTCCTCATCTTTTCCTCCTCCCTTTCCTCCTCTCTCCTCTCTCTCTTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.70% 10.30% 0.02% 0.00% A: 0.04%
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 70.10% 29.80% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 70.70% 29.30% 0.00% 0.00% NA
Tropical Japonica  504 60.90% 39.10% 0.00% 0.00% NA
Japonica Intermediate  241 87.60% 12.00% 0.41% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 85.60% 12.20% 0.00% 0.00% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405677437 G -> C LOC_Os04g10434.1 downstream_gene_variant ; 1700.0bp to feature; MODIFIER silent_mutation Average:48.261; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N
vg0405677437 G -> C LOC_Os04g10434-LOC_Os04g10450 intergenic_region ; MODIFIER silent_mutation Average:48.261; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N
vg0405677437 G -> A LOC_Os04g10434.1 downstream_gene_variant ; 1700.0bp to feature; MODIFIER silent_mutation Average:48.261; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N
vg0405677437 G -> A LOC_Os04g10434-LOC_Os04g10450 intergenic_region ; MODIFIER silent_mutation Average:48.261; most accessible tissue: Zhenshan97 young leaf, score: 65.28 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405677437 2.29E-12 NA mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437 1.17E-09 3.90E-13 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437 2.60E-11 NA mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437 1.34E-08 6.43E-12 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437 1.48E-08 2.38E-09 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437 2.37E-07 2.37E-07 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437 6.41E-12 NA mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437 8.59E-10 1.12E-12 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437 3.21E-06 NA mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437 6.70E-07 6.70E-07 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437 NA 1.92E-06 mr1648 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437 1.10E-10 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437 3.37E-07 6.41E-10 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437 8.82E-20 NA mr1062_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437 2.66E-14 5.34E-18 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437 7.63E-11 7.63E-11 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437 2.62E-08 2.62E-08 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437 1.67E-10 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437 4.21E-07 8.16E-12 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251