Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405677437:

Variant ID: vg0405677437 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5677437
Reference Allele: G	Alternative Allele: C,A
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAAAGAGAGAGAGGAGAGAGGAGGAAAGGGAGGAGGAAAAGATGAGGACAGGGTTTACGAGGAGGAGGAGAGGATAAGTGCGAGGGATTATATACGACGC[G/C,A]
TCGATCTTTAGTTCCGGTTGCTAACAGACAGGGGCCTGACACTTTTTGAATTGGGACTAAAATTGATCTTTGCTCCTGGTTGGTGTTACCAACCGGGACT

Reverse complement sequence

AGTCCCGGTTGGTAACACCAACCAGGAGCAAAGATCAATTTTAGTCCCAATTCAAAAAGTGTCAGGCCCCTGTCTGTTAGCAACCGGAACTAAAGATCGA[C/G,T]
GCGTCGTATATAATCCCTCGCACTTATCCTCTCCTCCTCCTCGTAAACCCTGTCCTCATCTTTTCCTCCTCCCTTTCCTCCTCTCTCCTCTCTCTCTTTC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.70%	10.30%	0.02%	0.00%	A: 0.04%
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	70.10%	29.80%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	99.10%	0.90%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	70.70%	29.30%	0.00%	0.00%	NA
Tropical Japonica	504	60.90%	39.10%	0.00%	0.00%	NA
Japonica Intermediate	241	87.60%	12.00%	0.41%	0.00%	NA
VI/Aromatic	96	87.50%	12.50%	0.00%	0.00%	NA
Intermediate	90	85.60%	12.20%	0.00%	0.00%	A: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405677437	G -> C	LOC_Os04g10434.1	downstream_gene_variant ; 1700.0bp to feature; MODIFIER	silent_mutation	Average:48.261; most accessible tissue: Zhenshan97 young leaf, score: 65.28	N	N	N	N
vg0405677437	G -> C	LOC_Os04g10434-LOC_Os04g10450	intergenic_region ; MODIFIER	silent_mutation	Average:48.261; most accessible tissue: Zhenshan97 young leaf, score: 65.28	N	N	N	N
vg0405677437	G -> A	LOC_Os04g10434.1	downstream_gene_variant ; 1700.0bp to feature; MODIFIER	silent_mutation	Average:48.261; most accessible tissue: Zhenshan97 young leaf, score: 65.28	N	N	N	N
vg0405677437	G -> A	LOC_Os04g10434-LOC_Os04g10450	intergenic_region ; MODIFIER	silent_mutation	Average:48.261; most accessible tissue: Zhenshan97 young leaf, score: 65.28	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405677437	2.29E-12	NA	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437	1.17E-09	3.90E-13	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437	2.60E-11	NA	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437	1.34E-08	6.43E-12	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437	1.48E-08	2.38E-09	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437	2.37E-07	2.37E-07	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437	6.41E-12	NA	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437	8.59E-10	1.12E-12	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437	3.21E-06	NA	mr1631	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437	6.70E-07	6.70E-07	mr1631	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437	NA	1.92E-06	mr1648	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437	1.10E-10	NA	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437	3.37E-07	6.41E-10	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437	8.82E-20	NA	mr1062_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437	2.66E-14	5.34E-18	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437	7.63E-11	7.63E-11	mr1525_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437	2.62E-08	2.62E-08	mr1525_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437	1.67E-10	NA	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405677437	4.21E-07	8.16E-12	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251