\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405652207:

Variant ID: vg0405652207 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5652207
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, T: 0.02, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


ATAATGGAGCAACCGGATCTAGCTAGCCTAGCTCTATCTTTATATTTAGTCCTGGTTGGTATTACCAACCGGGACTAAAAAGACTCTATCTCACCAACCA[T/G]
GACTAAAAATGGATTTTTACTCCCGGTTTTTTCACCCGGGACTAAAGATAGTGATCTTTAGACCCGAATTGGTAGTCCGGTTTGAAAACCGGGACTACAG

Reverse complement sequence

CTGTAGTCCCGGTTTTCAAACCGGACTACCAATTCGGGTCTAAAGATCACTATCTTTAGTCCCGGGTGAAAAAACCGGGAGTAAAAATCCATTTTTAGTC[A/C]
TGGTTGGTGAGATAGAGTCTTTTTAGTCCCGGTTGGTAATACCAACCAGGACTAAATATAAAGATAGAGCTAGGCTAGCTAGATCCGGTTGCTCCATTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.80% 25.30% 1.84% 0.99% NA
All Indica  2759 92.10% 6.50% 0.47% 0.94% NA
All Japonica  1512 28.30% 65.70% 4.63% 1.39% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 96.00% 4.00% 0.00% 0.00% NA
Indica II  465 86.00% 9.90% 0.00% 4.09% NA
Indica III  913 95.40% 3.50% 0.88% 0.22% NA
Indica Intermediate  786 88.80% 9.90% 0.64% 0.64% NA
Temperate Japonica  767 26.60% 65.80% 5.35% 2.22% NA
Tropical Japonica  504 36.90% 58.70% 3.97% 0.40% NA
Japonica Intermediate  241 15.80% 79.70% 3.73% 0.83% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 71.10% 24.40% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405652207 T -> DEL N N silent_mutation Average:34.688; most accessible tissue: Callus, score: 52.302 N N N N
vg0405652207 T -> G LOC_Os04g10410.1 downstream_gene_variant ; 2594.0bp to feature; MODIFIER silent_mutation Average:34.688; most accessible tissue: Callus, score: 52.302 N N N N
vg0405652207 T -> G LOC_Os04g10420.1 downstream_gene_variant ; 3640.0bp to feature; MODIFIER silent_mutation Average:34.688; most accessible tissue: Callus, score: 52.302 N N N N
vg0405652207 T -> G LOC_Os04g10410-LOC_Os04g10420 intergenic_region ; MODIFIER silent_mutation Average:34.688; most accessible tissue: Callus, score: 52.302 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405652207 3.66E-16 1.14E-31 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 9.05E-06 1.07E-07 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 5.54E-09 6.81E-12 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 1.85E-09 9.54E-24 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 6.22E-06 7.15E-09 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 1.70E-09 1.92E-06 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 3.06E-07 3.06E-07 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 3.65E-16 7.18E-29 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 NA 1.08E-06 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 2.88E-10 1.15E-13 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 1.42E-14 5.74E-40 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 NA 2.11E-06 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 7.12E-11 7.12E-11 mr1631 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 NA 7.17E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 1.57E-18 6.69E-31 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 7.65E-10 3.27E-13 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 1.85E-18 1.59E-34 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 3.87E-07 3.19E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 5.80E-10 1.04E-12 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 1.27E-08 1.30E-08 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 9.23E-07 9.02E-07 mr1525_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 5.82E-10 5.82E-10 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 1.02E-18 7.47E-49 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405652207 3.81E-10 1.46E-14 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251