\
| Variant ID: vg0405650134 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5650134 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CAAGAAGTCTGTCCAGATTTGTCCAGATTCATAGTATAAGTATATATCATATATGGAGTTGCCTATGAGGCACATTTTATTTTACTTTAGGTTATCCTTC[G/A]
TTCATATAGCGAATGAATTTCTAGGAATACCCCACCACGTTTGTTATTCAGGCCCCGTTTGGTAGGGCTCCGAACTCCAACTCCTAACTCTAAATTCCCA
TGGGAATTTAGAGTTAGGAGTTGGAGTTCGGAGCCCTACCAAACGGGGCCTGAATAACAAACGTGGTGGGGTATTCCTAGAAATTCATTCGCTATATGAA[C/T]
GAAGGATAACCTAAAGTAAAATAAAATGTGCCTCATAGGCAACTCCATATATGATATATACTTATACTATGAATCTGGACAAATCTGGACAGACTTCTTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.80% | 3.90% | 23.66% | 15.64% | NA |
| All Indica | 2759 | 44.30% | 0.10% | 34.36% | 21.28% | NA |
| All Japonica | 1512 | 81.60% | 12.00% | 1.46% | 4.96% | NA |
| Aus | 269 | 45.40% | 0.00% | 37.55% | 17.10% | NA |
| Indica I | 595 | 27.20% | 0.00% | 57.31% | 15.46% | NA |
| Indica II | 465 | 47.70% | 0.00% | 33.55% | 18.71% | NA |
| Indica III | 913 | 53.50% | 0.10% | 19.61% | 26.83% | NA |
| Indica Intermediate | 786 | 44.50% | 0.10% | 34.61% | 20.74% | NA |
| Temperate Japonica | 767 | 71.30% | 20.60% | 0.52% | 7.56% | NA |
| Tropical Japonica | 504 | 92.90% | 3.00% | 2.78% | 1.39% | NA |
| Japonica Intermediate | 241 | 90.90% | 3.30% | 1.66% | 4.15% | NA |
| VI/Aromatic | 96 | 51.00% | 0.00% | 29.17% | 19.79% | NA |
| Intermediate | 90 | 63.30% | 2.20% | 21.11% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405650134 | G -> DEL | N | N | silent_mutation | Average:61.01; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| vg0405650134 | G -> A | LOC_Os04g10410.1 | downstream_gene_variant ; 521.0bp to feature; MODIFIER | silent_mutation | Average:61.01; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| vg0405650134 | G -> A | LOC_Os04g10410-LOC_Os04g10420 | intergenic_region ; MODIFIER | silent_mutation | Average:61.01; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405650134 | 4.78E-08 | 8.90E-10 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405650134 | 8.68E-10 | 1.03E-14 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405650134 | 7.76E-08 | 7.76E-08 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405650134 | 1.84E-07 | 3.60E-09 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405650134 | 7.67E-07 | 2.92E-08 | mr1035_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405650134 | 5.10E-15 | 1.64E-20 | mr1062_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405650134 | 5.56E-08 | 5.56E-08 | mr1525_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405650134 | 1.70E-08 | 5.86E-12 | mr1631_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |