\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405650134:

Variant ID: vg0405650134 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5650134
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAGAAGTCTGTCCAGATTTGTCCAGATTCATAGTATAAGTATATATCATATATGGAGTTGCCTATGAGGCACATTTTATTTTACTTTAGGTTATCCTTC[G/A]
TTCATATAGCGAATGAATTTCTAGGAATACCCCACCACGTTTGTTATTCAGGCCCCGTTTGGTAGGGCTCCGAACTCCAACTCCTAACTCTAAATTCCCA

Reverse complement sequence

TGGGAATTTAGAGTTAGGAGTTGGAGTTCGGAGCCCTACCAAACGGGGCCTGAATAACAAACGTGGTGGGGTATTCCTAGAAATTCATTCGCTATATGAA[C/T]
GAAGGATAACCTAAAGTAAAATAAAATGTGCCTCATAGGCAACTCCATATATGATATATACTTATACTATGAATCTGGACAAATCTGGACAGACTTCTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.80% 3.90% 23.66% 15.64% NA
All Indica  2759 44.30% 0.10% 34.36% 21.28% NA
All Japonica  1512 81.60% 12.00% 1.46% 4.96% NA
Aus  269 45.40% 0.00% 37.55% 17.10% NA
Indica I  595 27.20% 0.00% 57.31% 15.46% NA
Indica II  465 47.70% 0.00% 33.55% 18.71% NA
Indica III  913 53.50% 0.10% 19.61% 26.83% NA
Indica Intermediate  786 44.50% 0.10% 34.61% 20.74% NA
Temperate Japonica  767 71.30% 20.60% 0.52% 7.56% NA
Tropical Japonica  504 92.90% 3.00% 2.78% 1.39% NA
Japonica Intermediate  241 90.90% 3.30% 1.66% 4.15% NA
VI/Aromatic  96 51.00% 0.00% 29.17% 19.79% NA
Intermediate  90 63.30% 2.20% 21.11% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405650134 G -> DEL N N silent_mutation Average:61.01; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N
vg0405650134 G -> A LOC_Os04g10410.1 downstream_gene_variant ; 521.0bp to feature; MODIFIER silent_mutation Average:61.01; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N
vg0405650134 G -> A LOC_Os04g10410-LOC_Os04g10420 intergenic_region ; MODIFIER silent_mutation Average:61.01; most accessible tissue: Minghui63 young leaf, score: 76.385 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405650134 4.78E-08 8.90E-10 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405650134 8.68E-10 1.03E-14 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405650134 7.76E-08 7.76E-08 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405650134 1.84E-07 3.60E-09 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405650134 7.67E-07 2.92E-08 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405650134 5.10E-15 1.64E-20 mr1062_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405650134 5.56E-08 5.56E-08 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405650134 1.70E-08 5.86E-12 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251