\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405636478:

Variant ID: vg0405636478 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5636478
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.07, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


CACTTCCCATTTATGAACACTTTCCTAGCTCAATGTTTTTGTCCTCTCGATTTATTAACTTGAAAATATTTCAGCTTTGAACCAAATTACCTTTACCAAG[C/T]
CAGCACTACATCCCACGAAACAACAGCAACGAGGTTGAAACGTAAATAGTTGTAGAGCTCAAGGCATATCTAGTGGAGACGAAACTAATTTTACCACATC

Reverse complement sequence

GATGTGGTAAAATTAGTTTCGTCTCCACTAGATATGCCTTGAGCTCTACAACTATTTACGTTTCAACCTCGTTGCTGTTGTTTCGTGGGATGTAGTGCTG[G/A]
CTTGGTAAAGGTAATTTGGTTCAAAGCTGAAATATTTTCAAGTTAATAAATCGAGAGGACAAAAACATTGAGCTAGGAAAGTGTTCATAAATGGGAAGTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.80% 26.20% 0.04% 0.00% NA
All Indica  2759 93.10% 6.90% 0.07% 0.00% NA
All Japonica  1512 32.30% 67.70% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 96.00% 4.00% 0.00% 0.00% NA
Indica II  465 89.70% 10.10% 0.22% 0.00% NA
Indica III  913 95.70% 4.20% 0.11% 0.00% NA
Indica Intermediate  786 89.80% 10.20% 0.00% 0.00% NA
Temperate Japonica  767 34.90% 65.10% 0.00% 0.00% NA
Tropical Japonica  504 33.90% 66.10% 0.00% 0.00% NA
Japonica Intermediate  241 20.30% 79.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405636478 C -> T LOC_Os04g10390.1 upstream_gene_variant ; 2375.0bp to feature; MODIFIER silent_mutation Average:71.568; most accessible tissue: Callus, score: 84.363 N N N N
vg0405636478 C -> T LOC_Os04g10400.1 downstream_gene_variant ; 266.0bp to feature; MODIFIER silent_mutation Average:71.568; most accessible tissue: Callus, score: 84.363 N N N N
vg0405636478 C -> T LOC_Os04g10390-LOC_Os04g10400 intergenic_region ; MODIFIER silent_mutation Average:71.568; most accessible tissue: Callus, score: 84.363 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405636478 7.72E-17 2.06E-32 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 3.37E-06 3.24E-08 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 2.39E-09 3.39E-12 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 3.35E-11 1.66E-26 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 NA 2.04E-09 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 2.20E-12 9.64E-08 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 1.61E-08 1.61E-08 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 4.99E-16 7.72E-29 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 7.77E-06 3.04E-07 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 9.14E-10 3.92E-13 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 4.18E-14 4.03E-40 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 NA 3.99E-07 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 6.58E-10 6.58E-10 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 6.78E-21 4.25E-33 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 4.12E-12 1.86E-15 mr1035_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 6.08E-18 1.16E-35 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 5.57E-08 3.95E-07 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 8.34E-09 1.41E-12 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 8.87E-09 9.14E-09 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 1.42E-07 2.39E-07 mr1525_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 2.02E-10 2.02E-10 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 4.99E-21 3.46E-52 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636478 1.89E-12 7.78E-17 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251