Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405636181:

Variant ID: vg0405636181 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5636181
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.11, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


CAAATCATGGAGTAATTAGGCTCTAAAGATTCGTCTCGCAATTTACATGTAAACTGTGCAATTGTTTTTTTTATCCACATTTAATACTCCATGCATACGT[T/C]
CAAATATTTGATGTGACGAAATTTTCGGAAGTTTGAAGGGGGACATAAACACGGCCTATATAAGTTGGGATGTGTGTTTTTGATGTATGGGTCCATGAGG

Reverse complement sequence

CCTCATGGACCCATACATCAAAAACACACATCCCAACTTATATAGGCCGTGTTTATGTCCCCCTTCAAACTTCCGAAAATTTCGTCACATCAAATATTTG[A/G]
ACGTATGCATGGAGTATTAAATGTGGATAAAAAAAACAATTGCACAGTTTACATGTAAATTGCGAGACGAATCTTTAGAGCCTAATTACTCCATGATTTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.30% 32.20% 0.15% 0.34% NA
All Indica  2759 69.60% 29.80% 0.18% 0.43% NA
All Japonica  1512 67.30% 32.70% 0.07% 0.00% NA
Aus  269 58.40% 40.90% 0.00% 0.74% NA
Indica I  595 98.30% 1.50% 0.00% 0.17% NA
Indica II  465 54.20% 45.60% 0.00% 0.22% NA
Indica III  913 55.40% 44.20% 0.22% 0.11% NA
Indica Intermediate  786 73.40% 25.10% 0.38% 1.15% NA
Temperate Japonica  767 65.20% 34.70% 0.13% 0.00% NA
Tropical Japonica  504 63.50% 36.50% 0.00% 0.00% NA
Japonica Intermediate  241 81.70% 18.30% 0.00% 0.00% NA
VI/Aromatic  96 38.50% 59.40% 0.00% 2.08% NA
Intermediate  90 56.70% 42.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405636181 T -> C LOC_Os04g10390.1 upstream_gene_variant ; 2078.0bp to feature; MODIFIER silent_mutation Average:63.179; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0405636181 T -> C LOC_Os04g10400.1 downstream_gene_variant ; 563.0bp to feature; MODIFIER silent_mutation Average:63.179; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0405636181 T -> C LOC_Os04g10390-LOC_Os04g10400 intergenic_region ; MODIFIER silent_mutation Average:63.179; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N
vg0405636181 T -> DEL N N silent_mutation Average:63.179; most accessible tissue: Minghui63 panicle, score: 79.811 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405636181 6.35E-13 7.13E-15 mr1035 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 2.19E-06 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 5.40E-09 4.85E-12 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 3.76E-10 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 1.97E-11 2.99E-15 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 1.77E-07 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 1.67E-06 4.02E-10 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 8.66E-13 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 2.76E-11 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 7.22E-12 1.37E-13 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 1.28E-08 1.28E-08 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 2.24E-11 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 3.95E-09 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 6.87E-13 2.03E-15 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 1.10E-07 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 2.02E-09 6.27E-13 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 4.62E-09 NA mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 7.91E-10 7.91E-10 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 1.05E-11 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 3.36E-10 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 1.32E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 7.87E-12 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 8.37E-13 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 9.91E-13 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 2.06E-10 3.96E-14 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 2.92E-18 1.70E-22 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 8.56E-07 2.38E-15 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 9.42E-11 4.57E-14 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 1.01E-09 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 7.40E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 3.16E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 1.02E-06 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 3.18E-09 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 3.41E-08 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 6.87E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 2.41E-13 2.41E-13 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 1.15E-10 1.15E-10 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 8.64E-09 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 4.54E-13 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 7.43E-11 5.87E-16 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 9.59E-12 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 5.51E-06 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 3.75E-11 mr1794_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 4.14E-10 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 7.33E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405636181 NA 3.01E-09 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251