\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405604220:

Variant ID: vg0405604220 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5604220
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.01, others allele: 0.00, population size: 173. )

Flanking Sequence (100 bp) in Reference Genome:


GTGTAAGGAATAACCAACATAGAGCAGCCTTTAATTTGTAAAATTTTTAGAAAATTCATTTTTAGTCCAAATGAAATGAACTAAGTTTCTTTAGAACCAG[C/A]
AAATAGTGAGTTTCATCATAGTAAAATAAAATATGACACCTTTTGTACAAATTATAGCTCTAATCTTTAAATAGATAACCTAGGAGTTAATCACCAAGTG

Reverse complement sequence

CACTTGGTGATTAACTCCTAGGTTATCTATTTAAAGATTAGAGCTATAATTTGTACAAAAGGTGTCATATTTTATTTTACTATGATGAAACTCACTATTT[G/T]
CTGGTTCTAAAGAAACTTAGTTCATTTCATTTGGACTAAAAATGAATTTTCTAAAAATTTTACAAATTAAAGGCTGCTCTATGTTGGTTATTCCTTACAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.80% 7.90% 1.23% 3.07% NA
All Indica  2759 96.40% 0.50% 1.12% 1.99% NA
All Japonica  1512 70.10% 22.90% 1.46% 5.49% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 95.50% 0.20% 0.43% 3.87% NA
Indica III  913 93.30% 0.90% 2.96% 2.85% NA
Indica Intermediate  786 97.80% 0.50% 0.25% 1.40% NA
Temperate Japonica  767 65.80% 33.90% 0.13% 0.13% NA
Tropical Japonica  504 69.60% 11.70% 3.77% 14.88% NA
Japonica Intermediate  241 84.60% 11.60% 0.83% 2.90% NA
VI/Aromatic  96 89.60% 5.20% 1.04% 4.17% NA
Intermediate  90 84.40% 7.80% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405604220 C -> DEL N N silent_mutation Average:52.71; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0405604220 C -> A LOC_Os04g10370.1 upstream_gene_variant ; 1262.0bp to feature; MODIFIER silent_mutation Average:52.71; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0405604220 C -> A LOC_Os04g10380.1 upstream_gene_variant ; 4520.0bp to feature; MODIFIER silent_mutation Average:52.71; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N
vg0405604220 C -> A LOC_Os04g10370-LOC_Os04g10380 intergenic_region ; MODIFIER silent_mutation Average:52.71; most accessible tissue: Minghui63 panicle, score: 73.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405604220 3.30E-11 NA mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405604220 1.47E-08 3.53E-12 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405604220 6.00E-08 NA mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405604220 3.53E-06 1.99E-10 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405604220 9.42E-08 1.06E-08 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405604220 9.29E-08 9.29E-08 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405604220 1.75E-11 NA mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405604220 1.96E-09 5.81E-13 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405604220 1.17E-08 NA mr1631 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405604220 1.46E-09 1.46E-09 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405604220 4.63E-14 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405604220 3.81E-10 1.39E-13 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405604220 1.46E-14 NA mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405604220 6.70E-10 1.51E-14 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405604220 4.55E-11 4.56E-11 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405604220 3.78E-09 3.78E-09 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405604220 7.09E-16 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405604220 1.30E-11 7.38E-17 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251