\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405571324:

Variant ID: vg0405571324 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5571324
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.02, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


CCACTGAGAAAAAAGTATTAGGAAAGAACAAGTAAAAGTCTTCGGGTGCAAAGCCACTGCCAACTTCGTACCATAGAAGCCGATAGTGGTGGTTCCGAGC[A/G]
GGGGGACAAGGCAGATACCGTCGAAGAGGTGAAGTGGGCAGGAGCAGGGTGGATCAACGGTAGGAATTTCGATTGGTCGAGGCACTTGTGGGAGGCGAGG

Reverse complement sequence

CCTCGCCTCCCACAAGTGCCTCGACCAATCGAAATTCCTACCGTTGATCCACCCTGCTCCTGCCCACTTCACCTCTTCGACGGTATCTGCCTTGTCCCCC[T/C]
GCTCGGAACCACCACTATCGGCTTCTATGGTACGAAGTTGGCAGTGGCTTTGCACCCGAAGACTTTTACTTGTTCTTTCCTAATACTTTTTTCTCAGTGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.90% 8.00% 0.02% 0.00% NA
All Indica  2759 99.10% 0.90% 0.04% 0.00% NA
All Japonica  1512 77.70% 22.30% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 97.40% 2.50% 0.11% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 77.10% 22.90% 0.00% 0.00% NA
Tropical Japonica  504 73.00% 27.00% 0.00% 0.00% NA
Japonica Intermediate  241 89.60% 10.40% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405571324 A -> G LOC_Os04g10310.1 upstream_gene_variant ; 965.0bp to feature; MODIFIER silent_mutation Average:62.531; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N
vg0405571324 A -> G LOC_Os04g10320.1 intron_variant ; MODIFIER silent_mutation Average:62.531; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405571324 3.51E-08 NA mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405571324 5.20E-07 9.77E-08 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405571324 2.13E-11 NA mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405571324 7.24E-08 2.29E-11 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405571324 2.79E-09 8.64E-10 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405571324 9.60E-08 9.60E-08 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405571324 4.49E-07 NA mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405571324 3.50E-06 1.07E-07 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405571324 7.42E-06 NA mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405571324 2.88E-06 2.88E-06 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405571324 4.17E-13 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405571324 6.11E-10 1.44E-11 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405571324 2.12E-11 NA mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405571324 7.86E-08 2.02E-10 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405571324 3.37E-10 3.38E-10 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405571324 2.23E-07 2.23E-07 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405571324 4.14E-17 NA mr1631_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405571324 8.97E-13 2.65E-16 mr1631_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251