\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405563927:

Variant ID: vg0405563927 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5563927
Reference Allele: CAlternative Allele: G,A
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, G: 0.01, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


CAGTGTTTTTCATATATCATGTTCAGAATCCACAAAAATACAATGAATCAAGCAGATATCATTGCCATAATCCACAACACATAATGAAATTAGGGTGTCT[C/G,A]
TTGCTGGTATCATGTTTAGAATCCACATAACACAATGAATTTAGGCGGCCTCTTACAGGTATCATGTTCATAATTGTCAGTTACGGTCGAATATGTGTAC

Reverse complement sequence

GTACACATATTCGACCGTAACTGACAATTATGAACATGATACCTGTAAGAGGCCGCCTAAATTCATTGTGTTATGTGGATTCTAAACATGATACCAGCAA[G/C,T]
AGACACCCTAATTTCATTATGTGTTGTGGATTATGGCAATGATATCTGCTTGATTCATTGTATTTTTGTGGATTCTGAACATGATATATGAAAAACACTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.80% 6.60% 0.06% 0.00% A: 0.57%
All Indica  2759 98.90% 0.00% 0.11% 0.00% A: 0.94%
All Japonica  1512 80.40% 19.60% 0.00% 0.00% A: 0.07%
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 95.30% 0.00% 0.65% 0.00% A: 4.09%
Indica III  913 99.90% 0.00% 0.00% 0.00% A: 0.11%
Indica Intermediate  786 99.10% 0.10% 0.00% 0.00% A: 0.76%
Temperate Japonica  767 79.70% 20.30% 0.00% 0.00% NA
Tropical Japonica  504 74.40% 25.60% 0.00% 0.00% NA
Japonica Intermediate  241 95.00% 4.60% 0.00% 0.00% A: 0.41%
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405563927 C -> A LOC_Os04g10290.1 upstream_gene_variant ; 2724.0bp to feature; MODIFIER silent_mutation Average:36.417; most accessible tissue: Callus, score: 68.23 N N N N
vg0405563927 C -> A LOC_Os04g10310.1 downstream_gene_variant ; 2884.0bp to feature; MODIFIER silent_mutation Average:36.417; most accessible tissue: Callus, score: 68.23 N N N N
vg0405563927 C -> A LOC_Os04g10300.1 intron_variant ; MODIFIER silent_mutation Average:36.417; most accessible tissue: Callus, score: 68.23 N N N N
vg0405563927 C -> G LOC_Os04g10290.1 upstream_gene_variant ; 2724.0bp to feature; MODIFIER silent_mutation Average:36.417; most accessible tissue: Callus, score: 68.23 N N N N
vg0405563927 C -> G LOC_Os04g10310.1 downstream_gene_variant ; 2884.0bp to feature; MODIFIER silent_mutation Average:36.417; most accessible tissue: Callus, score: 68.23 N N N N
vg0405563927 C -> G LOC_Os04g10300.1 intron_variant ; MODIFIER silent_mutation Average:36.417; most accessible tissue: Callus, score: 68.23 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405563927 1.41E-07 NA mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405563927 1.06E-06 9.49E-07 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405563927 2.90E-14 NA mr1062 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405563927 3.26E-10 9.58E-13 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405563927 8.73E-11 1.04E-10 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405563927 2.82E-08 2.82E-08 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405563927 7.64E-07 NA mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405563927 4.08E-06 4.73E-07 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405563927 4.35E-11 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405563927 1.34E-08 1.03E-09 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405563927 2.39E-15 NA mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405563927 5.33E-11 3.08E-12 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405563927 6.58E-11 6.58E-11 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405563927 8.44E-08 8.44E-08 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405563927 6.98E-14 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405563927 3.34E-10 2.84E-13 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251