\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405542769:

Variant ID: vg0405542769 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5542769
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.87, T: 0.13, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


ATATTAGGTTGTATTGAACTGTCAGGTTCATCTCTCTCTCTTAATTTGTTCTAGCTCAGTGTCCAAGCGGTAAAGTTGAATAGAATCTTCAACCATGCCC[T/C]
TTGCGCTTATAGATTCATTTGTAATAATGTTGTTTTGTACACTTTTAGTTTTATTTTGAAGTGCTTTGACTTGAAATATTGGTGAGAGCGTAAGCTGACA

Reverse complement sequence

TGTCAGCTTACGCTCTCACCAATATTTCAAGTCAAAGCACTTCAAAATAAAACTAAAAGTGTACAAAACAACATTATTACAAATGAATCTATAAGCGCAA[A/G]
GGGCATGGTTGAAGATTCTATTCAACTTTACCGCTTGGACACTGAGCTAGAACAAATTAAGAGAGAGAGATGAACCTGACAGTTCAATACAACCTAATAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.40% 26.60% 0.02% 0.00% NA
All Indica  2759 92.40% 7.50% 0.04% 0.00% NA
All Japonica  1512 32.30% 67.70% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 85.40% 14.60% 0.00% 0.00% NA
Indica III  913 96.30% 3.60% 0.11% 0.00% NA
Indica Intermediate  786 89.30% 10.70% 0.00% 0.00% NA
Temperate Japonica  767 35.20% 64.80% 0.00% 0.00% NA
Tropical Japonica  504 33.90% 66.10% 0.00% 0.00% NA
Japonica Intermediate  241 19.90% 80.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405542769 T -> C LOC_Os04g10270.1 upstream_gene_variant ; 4936.0bp to feature; MODIFIER silent_mutation Average:47.253; most accessible tissue: Callus, score: 85.714 N N N N
vg0405542769 T -> C LOC_Os04g10250.1 downstream_gene_variant ; 4505.0bp to feature; MODIFIER silent_mutation Average:47.253; most accessible tissue: Callus, score: 85.714 N N N N
vg0405542769 T -> C LOC_Os04g10260.1 intron_variant ; MODIFIER silent_mutation Average:47.253; most accessible tissue: Callus, score: 85.714 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405542769 1.36E-18 5.92E-34 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 1.77E-09 2.52E-11 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 5.40E-09 4.85E-12 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 2.54E-11 2.58E-27 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 1.67E-06 4.02E-10 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 1.82E-12 7.04E-09 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 1.28E-08 1.28E-08 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 2.19E-17 7.11E-30 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 2.93E-08 2.11E-09 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 2.02E-09 6.27E-13 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 2.73E-15 5.62E-40 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 9.57E-08 1.03E-08 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 7.91E-10 7.91E-10 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 4.75E-21 2.41E-33 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 2.12E-06 2.12E-06 mr1035_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 2.06E-10 3.96E-14 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 6.16E-22 5.25E-38 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 1.00E-09 8.96E-09 mr1062_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 9.42E-11 4.57E-14 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 1.10E-10 1.14E-10 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 9.78E-09 2.53E-09 mr1525_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 1.15E-10 1.15E-10 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 1.11E-20 6.53E-52 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 4.20E-06 7.37E-07 mr1631_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405542769 7.43E-11 5.87E-16 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251