Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0405540593:

Variant ID: vg0405540593 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5540593
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, G: 0.17, others allele: 0.00, population size: 35. )

Flanking Sequence (100 bp) in Reference Genome:


AGTTTGAAAACATGTGTCTGCAATCCGCAATAATCGAAGGCCCTGCGAGACGATCTCGATCAACAAGAGGGCACTCAACCATATCCTACTTTTGTCTTGT[T/G]
CTCTCCATATATCTCTTGCTATCGTCTTGCGTTCAACTAGAGGCTATAGGCCCCAAGGAAAAAACTAGTCCCTCCCTCTAAAAATTTAAGGGATTTTGGG

Reverse complement sequence

CCCAAAATCCCTTAAATTTTTAGAGGGAGGGACTAGTTTTTTCCTTGGGGCCTATAGCCTCTAGTTGAACGCAAGACGATAGCAAGAGATATATGGAGAG[A/C]
ACAAGACAAAAGTAGGATATGGTTGAGTGCCCTCTTGTTGATCGAGATCGTCTCGCAGGGCCTTCGATTATTGCGGATTGCAGACACATGTTTTCAAACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.10% 20.70% 0.13% 0.00% NA
All Indica  2759 85.20% 14.60% 0.14% 0.00% NA
All Japonica  1512 75.00% 24.90% 0.07% 0.00% NA
Aus  269 58.40% 41.30% 0.37% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 61.10% 38.70% 0.22% 0.00% NA
Indica III  913 89.50% 10.40% 0.11% 0.00% NA
Indica Intermediate  786 84.10% 15.60% 0.25% 0.00% NA
Temperate Japonica  767 72.80% 27.10% 0.13% 0.00% NA
Tropical Japonica  504 72.60% 27.40% 0.00% 0.00% NA
Japonica Intermediate  241 87.10% 12.90% 0.00% 0.00% NA
VI/Aromatic  96 38.50% 61.50% 0.00% 0.00% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405540593 T -> G LOC_Os04g10250.1 downstream_gene_variant ; 2329.0bp to feature; MODIFIER silent_mutation Average:55.769; most accessible tissue: Zhenshan97 flower, score: 70.106 N N N N
vg0405540593 T -> G LOC_Os04g10260.1 intron_variant ; MODIFIER silent_mutation Average:55.769; most accessible tissue: Zhenshan97 flower, score: 70.106 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405540593 5.39E-09 NA mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 4.61E-06 2.73E-07 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 NA 2.86E-08 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 4.29E-15 1.06E-19 mr1062 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 9.17E-09 3.51E-12 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 1.49E-06 2.14E-10 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 NA 3.40E-10 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 NA 3.64E-09 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 3.32E-14 1.48E-16 mr1525 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 5.34E-07 1.59E-07 mr1525 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 4.40E-08 4.40E-08 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 NA 1.07E-08 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 2.70E-08 NA mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 NA 6.43E-06 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 5.98E-06 7.40E-08 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 1.13E-06 NA mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 6.81E-07 6.81E-07 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 NA 2.45E-09 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 NA 2.83E-08 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 NA 2.43E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 NA 2.72E-09 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 NA 2.45E-10 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 1.38E-11 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 1.07E-08 1.54E-10 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 2.25E-18 6.35E-24 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 2.78E-10 2.89E-20 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 8.89E-09 2.61E-12 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 NA 1.31E-08 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 NA 3.29E-07 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 NA 6.67E-08 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 NA 3.28E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 NA 7.64E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 4.13E-14 4.12E-14 mr1525_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 2.14E-06 5.52E-08 mr1525_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 1.47E-08 1.47E-08 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 1.15E-14 NA mr1631_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 3.25E-11 9.21E-14 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 NA 3.71E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405540593 NA 3.22E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251