\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405539066:

Variant ID: vg0405539066 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5539066
Reference Allele: GAlternative Allele: T
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 30. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATAATTAGGGGCCTAGATGTACTTTCATTAGTCAGACGTGAAGAAAAAGTTTCGTCTAAGTTTTTAACAATACCTTAGTGCCCCTACACTTGTGAAA[G/T]
GATGCAAATTGGAAATGACTGATCCGAAACCGTGATTATGCCTGTCTTTCAGAAGTTGTGTATACTTAGTTCACTAGTATAATTGCAATTACATTTTTGT

Reverse complement sequence

ACAAAAATGTAATTGCAATTATACTAGTGAACTAAGTATACACAACTTCTGAAAGACAGGCATAATCACGGTTTCGGATCAGTCATTTCCAATTTGCATC[C/A]
TTTCACAAGTGTAGGGGCACTAAGGTATTGTTAAAAACTTAGACGAAACTTTTTCTTCACGTCTGACTAATGAAAGTACATCTAGGCCCCTAATTATTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 26.80% 3.32% 5.59% NA
All Indica  2759 77.70% 8.60% 5.29% 8.48% NA
All Japonica  1512 33.20% 66.50% 0.00% 0.26% NA
Aus  269 91.40% 0.40% 1.49% 6.69% NA
Indica I  595 79.80% 5.20% 9.08% 5.88% NA
Indica II  465 69.00% 16.30% 6.02% 8.60% NA
Indica III  913 83.80% 4.20% 2.08% 9.97% NA
Indica Intermediate  786 74.00% 11.60% 5.73% 8.65% NA
Temperate Japonica  767 35.10% 64.90% 0.00% 0.00% NA
Tropical Japonica  504 37.30% 62.50% 0.00% 0.20% NA
Japonica Intermediate  241 18.70% 80.10% 0.00% 1.24% NA
VI/Aromatic  96 89.60% 0.00% 3.12% 7.29% NA
Intermediate  90 68.90% 25.60% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405539066 G -> DEL N N silent_mutation Average:38.281; most accessible tissue: Callus, score: 66.862 N N N N
vg0405539066 G -> T LOC_Os04g10250.1 downstream_gene_variant ; 802.0bp to feature; MODIFIER silent_mutation Average:38.281; most accessible tissue: Callus, score: 66.862 N N N N
vg0405539066 G -> T LOC_Os04g10260.1 downstream_gene_variant ; 508.0bp to feature; MODIFIER silent_mutation Average:38.281; most accessible tissue: Callus, score: 66.862 N N N N
vg0405539066 G -> T LOC_Os04g10250-LOC_Os04g10260 intergenic_region ; MODIFIER silent_mutation Average:38.281; most accessible tissue: Callus, score: 66.862 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405539066 6.01E-06 2.54E-07 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 NA 1.06E-11 mr1059 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 1.69E-06 1.71E-10 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 NA 3.49E-12 mr1143 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 NA 2.23E-11 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 NA 3.78E-06 mr1192 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 6.29E-08 6.29E-08 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 NA 1.42E-11 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 2.80E-06 1.96E-08 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 4.63E-07 4.63E-07 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 NA 6.60E-12 mr1675 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 NA 1.66E-08 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 3.22E-06 NA mr1950 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 2.34E-06 4.93E-11 mr1950 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 NA 6.60E-11 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 NA 2.06E-11 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 1.16E-09 5.16E-12 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 5.03E-08 4.08E-11 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 7.78E-06 NA mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 2.05E-09 5.41E-16 mr1167_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 NA 3.87E-06 mr1479_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 NA 1.04E-07 mr1502_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 2.17E-08 2.17E-08 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 5.42E-06 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 3.69E-12 3.39E-16 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 NA 9.79E-06 mr1669_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 8.02E-07 1.81E-08 mr1698_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 8.10E-06 1.90E-09 mr1726_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 NA 4.02E-07 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405539066 2.73E-08 1.65E-11 mr1950_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251