| Variant ID: vg0405539066 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5539066 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 30. )
AAAATAATTAGGGGCCTAGATGTACTTTCATTAGTCAGACGTGAAGAAAAAGTTTCGTCTAAGTTTTTAACAATACCTTAGTGCCCCTACACTTGTGAAA[G/T]
GATGCAAATTGGAAATGACTGATCCGAAACCGTGATTATGCCTGTCTTTCAGAAGTTGTGTATACTTAGTTCACTAGTATAATTGCAATTACATTTTTGT
ACAAAAATGTAATTGCAATTATACTAGTGAACTAAGTATACACAACTTCTGAAAGACAGGCATAATCACGGTTTCGGATCAGTCATTTCCAATTTGCATC[C/A]
TTTCACAAGTGTAGGGGCACTAAGGTATTGTTAAAAACTTAGACGAAACTTTTTCTTCACGTCTGACTAATGAAAGTACATCTAGGCCCCTAATTATTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.30% | 26.80% | 3.32% | 5.59% | NA |
| All Indica | 2759 | 77.70% | 8.60% | 5.29% | 8.48% | NA |
| All Japonica | 1512 | 33.20% | 66.50% | 0.00% | 0.26% | NA |
| Aus | 269 | 91.40% | 0.40% | 1.49% | 6.69% | NA |
| Indica I | 595 | 79.80% | 5.20% | 9.08% | 5.88% | NA |
| Indica II | 465 | 69.00% | 16.30% | 6.02% | 8.60% | NA |
| Indica III | 913 | 83.80% | 4.20% | 2.08% | 9.97% | NA |
| Indica Intermediate | 786 | 74.00% | 11.60% | 5.73% | 8.65% | NA |
| Temperate Japonica | 767 | 35.10% | 64.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 37.30% | 62.50% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 18.70% | 80.10% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 89.60% | 0.00% | 3.12% | 7.29% | NA |
| Intermediate | 90 | 68.90% | 25.60% | 4.44% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405539066 | G -> DEL | N | N | silent_mutation | Average:38.281; most accessible tissue: Callus, score: 66.862 | N | N | N | N |
| vg0405539066 | G -> T | LOC_Os04g10250.1 | downstream_gene_variant ; 802.0bp to feature; MODIFIER | silent_mutation | Average:38.281; most accessible tissue: Callus, score: 66.862 | N | N | N | N |
| vg0405539066 | G -> T | LOC_Os04g10260.1 | downstream_gene_variant ; 508.0bp to feature; MODIFIER | silent_mutation | Average:38.281; most accessible tissue: Callus, score: 66.862 | N | N | N | N |
| vg0405539066 | G -> T | LOC_Os04g10250-LOC_Os04g10260 | intergenic_region ; MODIFIER | silent_mutation | Average:38.281; most accessible tissue: Callus, score: 66.862 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405539066 | 6.01E-06 | 2.54E-07 | mr1035 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405539066 | NA | 1.06E-11 | mr1059 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405539066 | 1.69E-06 | 1.71E-10 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405539066 | NA | 3.49E-12 | mr1143 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405539066 | NA | 2.23E-11 | mr1167 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405539066 | NA | 3.78E-06 | mr1192 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405539066 | 6.29E-08 | 6.29E-08 | mr1525 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405539066 | NA | 1.42E-11 | mr1535 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405539066 | 2.80E-06 | 1.96E-08 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405539066 | 4.63E-07 | 4.63E-07 | mr1631 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/