\
| Variant ID: vg0405536257 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5536257 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AACATGTGTTCCCGGCCACCATGAGTCAATCTATGCCCTCAGCCGCATTAGCAGCAGCGGCGCCACCGGTTTCCCTCACCGCGACTAAGGAGGATGAGGC[C/T]
GACATGGACAAATCTGAGATGAAACCAGAGGAGACATTCCAAGAGTTGTGTGCCAAGATGATTGCCATGCTCAACAACATGCTCGTGACATGCTGCGACA
TGTCGCAGCATGTCACGAGCATGTTGTTGAGCATGGCAATCATCTTGGCACACAACTCTTGGAATGTCTCCTCTGGTTTCATCTCAGATTTGTCCATGTC[G/A]
GCCTCATCCTCCTTAGTCGCGGTGAGGGAAACCGGTGGCGCCGCTGCTGCTAATGCGGCTGAGGGCATAGATTGACTCATGGTGGCCGGGAACACATGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 33.70% | 5.40% | 3.66% | 57.30% | NA |
| All Indica | 2759 | 14.70% | 9.00% | 4.86% | 71.51% | NA |
| All Japonica | 1512 | 67.40% | 0.10% | 0.46% | 32.01% | NA |
| Aus | 269 | 51.30% | 0.00% | 6.69% | 42.01% | NA |
| Indica I | 595 | 5.20% | 4.20% | 3.03% | 87.56% | NA |
| Indica II | 465 | 19.40% | 16.10% | 6.88% | 57.63% | NA |
| Indica III | 913 | 15.40% | 13.50% | 5.37% | 65.72% | NA |
| Indica Intermediate | 786 | 18.20% | 3.10% | 4.45% | 74.30% | NA |
| Temperate Japonica | 767 | 66.00% | 0.10% | 0.52% | 33.38% | NA |
| Tropical Japonica | 504 | 63.50% | 0.00% | 0.20% | 36.31% | NA |
| Japonica Intermediate | 241 | 80.10% | 0.40% | 0.83% | 18.67% | NA |
| VI/Aromatic | 96 | 0.00% | 0.00% | 9.38% | 90.62% | NA |
| Intermediate | 90 | 33.30% | 4.40% | 5.56% | 56.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405536257 | C -> DEL | LOC_Os04g10250.1 | N | frameshift_variant | Average:49.642; most accessible tissue: Minghui63 flag leaf, score: 87.98 | N | N | N | N |
| vg0405536257 | C -> T | LOC_Os04g10250.1 | synonymous_variant ; p.Ala167Ala; LOW | synonymous_codon | Average:49.642; most accessible tissue: Minghui63 flag leaf, score: 87.98 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405536257 | NA | 1.65E-17 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405536257 | 7.41E-08 | 7.70E-10 | mr1035 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405536257 | 1.03E-06 | 2.92E-18 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405536257 | 1.04E-07 | 1.98E-08 | mr1062 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405536257 | 6.25E-06 | NA | mr1525 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405536257 | 2.24E-08 | 6.99E-09 | mr1525 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405536257 | NA | 1.64E-14 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405536257 | 3.57E-06 | 1.02E-07 | mr1626 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405536257 | NA | 4.27E-06 | mr1631 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405536257 | NA | 4.42E-08 | mr1806 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405536257 | NA | 2.00E-14 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405536257 | 4.58E-06 | 4.58E-06 | mr1035_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405536257 | NA | 3.83E-19 | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405536257 | 1.08E-07 | 5.14E-09 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405536257 | 8.30E-07 | 3.47E-08 | mr1525_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405536257 | 4.48E-06 | 7.01E-07 | mr1631_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |