\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405534646:

Variant ID: vg0405534646 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5534646
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.89, G: 0.11, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


AACCATCAAAATAATTGGGTTATTTTGGATCCATGCCATTGCAAATACACCAATTCAGACAAATACTACTATAATTCATCTATTTGTAGTCATGCCATCC[G/A]
AATATGAACAAAATTAGAACCATGTCATCACCAATTCACCGTCACATTTTCTATCTTCTTCCCCAATTTCTTCTCTCTCTCTCTCTCTACCTTCCTCCTC

Reverse complement sequence

GAGGAGGAAGGTAGAGAGAGAGAGAGAGAAGAAATTGGGGAAGAAGATAGAAAATGTGACGGTGAATTGGTGATGACATGGTTCTAATTTTGTTCATATT[C/T]
GGATGGCATGACTACAAATAGATGAATTATAGTAGTATTTGTCTGAATTGGTGTATTTGCAATGGCATGGATCCAAAATAACCCAATTATTTTGATGGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.20% 26.70% 0.11% 0.00% NA
All Indica  2759 92.30% 7.60% 0.11% 0.00% NA
All Japonica  1512 32.30% 67.70% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 84.70% 14.80% 0.43% 0.00% NA
Indica III  913 96.40% 3.60% 0.00% 0.00% NA
Indica Intermediate  786 89.10% 10.80% 0.13% 0.00% NA
Temperate Japonica  767 35.10% 64.80% 0.13% 0.00% NA
Tropical Japonica  504 33.90% 66.10% 0.00% 0.00% NA
Japonica Intermediate  241 19.90% 80.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405534646 G -> A LOC_Os04g10240.1 upstream_gene_variant ; 4300.0bp to feature; MODIFIER silent_mutation Average:57.554; most accessible tissue: Minghui63 flag leaf, score: 74.563 N N N N
vg0405534646 G -> A LOC_Os04g10250.1 upstream_gene_variant ; 311.0bp to feature; MODIFIER silent_mutation Average:57.554; most accessible tissue: Minghui63 flag leaf, score: 74.563 N N N N
vg0405534646 G -> A LOC_Os04g10240.2 upstream_gene_variant ; 4300.0bp to feature; MODIFIER silent_mutation Average:57.554; most accessible tissue: Minghui63 flag leaf, score: 74.563 N N N N
vg0405534646 G -> A LOC_Os04g10260.1 downstream_gene_variant ; 4928.0bp to feature; MODIFIER silent_mutation Average:57.554; most accessible tissue: Minghui63 flag leaf, score: 74.563 N N N N
vg0405534646 G -> A LOC_Os04g10240-LOC_Os04g10250 intergenic_region ; MODIFIER silent_mutation Average:57.554; most accessible tissue: Minghui63 flag leaf, score: 74.563 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405534646 1.22E-19 5.69E-35 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 7.88E-11 1.00E-12 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 5.40E-09 4.85E-12 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 1.46E-11 3.46E-27 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 1.67E-06 4.02E-10 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 5.38E-12 1.37E-08 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 1.28E-08 1.28E-08 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 3.08E-18 8.42E-31 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 2.18E-09 1.07E-10 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 2.02E-09 6.27E-13 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 1.73E-16 1.30E-41 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 2.75E-09 1.78E-10 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 7.91E-10 7.91E-10 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 9.40E-21 5.22E-33 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 3.87E-06 3.87E-06 mr1035_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 2.06E-10 3.96E-14 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 3.00E-19 2.22E-35 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 4.96E-07 9.60E-07 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 9.42E-11 4.57E-14 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 3.33E-09 3.42E-09 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 NA 3.75E-06 mr1525_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 1.15E-10 1.15E-10 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 2.22E-22 1.76E-53 mr1631_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 1.99E-07 4.16E-08 mr1631_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405534646 7.43E-11 5.87E-16 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251