\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405532937:

Variant ID: vg0405532937 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5532937
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TATGAAAATTCTGAAAATCATAGATAAAGCGATATACACAAGTTAAACTAGATCTAGCTAGGCACAAGTATGGAAGGAATGCACCATCTAAACTACTAGC[A/G]
GCACAAAATAACAAAGCTAGAGGAGTAAGAGAGGGATATCACCGGGATTCTTGCAAGTTAATGTGTTCCCGAAGTTCGAATTCGTGAGAGGATTCTACTC

Reverse complement sequence

GAGTAGAATCCTCTCACGAATTCGAACTTCGGGAACACATTAACTTGCAAGAATCCCGGTGATATCCCTCTCTTACTCCTCTAGCTTTGTTATTTTGTGC[T/C]
GCTAGTAGTTTAGATGGTGCATTCCTTCCATACTTGTGCCTAGCTAGATCTAGTTTAACTTGTGTATATCGCTTTATCTATGATTTTCAGAATTTTCATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 33.40% 0.11% 0.00% NA
All Indica  2759 80.00% 19.90% 0.18% 0.00% NA
All Japonica  1512 33.40% 66.60% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 80.20% 19.10% 0.65% 0.00% NA
Indica III  913 69.10% 30.80% 0.11% 0.00% NA
Indica Intermediate  786 80.20% 19.70% 0.13% 0.00% NA
Temperate Japonica  767 34.90% 65.10% 0.00% 0.00% NA
Tropical Japonica  504 37.50% 62.50% 0.00% 0.00% NA
Japonica Intermediate  241 19.90% 80.10% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405532937 A -> G LOC_Os04g10240.1 upstream_gene_variant ; 2591.0bp to feature; MODIFIER silent_mutation Average:42.568; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0405532937 A -> G LOC_Os04g10250.1 upstream_gene_variant ; 2020.0bp to feature; MODIFIER silent_mutation Average:42.568; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0405532937 A -> G LOC_Os04g10240.2 upstream_gene_variant ; 2591.0bp to feature; MODIFIER silent_mutation Average:42.568; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N
vg0405532937 A -> G LOC_Os04g10240-LOC_Os04g10250 intergenic_region ; MODIFIER silent_mutation Average:42.568; most accessible tissue: Minghui63 young leaf, score: 61.007 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405532937 4.08E-16 1.34E-29 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 2.10E-07 9.27E-08 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 1.81E-08 1.06E-11 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 4.04E-12 7.01E-28 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 1.29E-06 2.85E-10 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 2.75E-13 9.28E-11 mr1525 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 8.00E-06 1.23E-07 mr1525 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 9.38E-09 9.38E-09 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 1.01E-14 1.66E-25 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 5.45E-06 4.59E-06 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 4.71E-09 1.12E-12 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 7.60E-13 1.86E-33 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 7.56E-06 NA mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 2.55E-09 2.55E-09 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 2.35E-17 9.06E-29 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 2.45E-10 4.23E-14 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 3.98E-17 5.52E-32 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 1.82E-06 4.50E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 5.31E-10 1.38E-13 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 1.05E-10 1.08E-10 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 1.96E-06 1.54E-08 mr1525_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 3.44E-10 3.44E-10 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 3.25E-19 2.65E-46 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532937 7.40E-11 7.95E-16 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251