Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405532107:

Variant ID: vg0405532107 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5532107
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, A: 0.19, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:

GGTCTCTAAACTTTATGTGTATAAAATTTAGATGTGTAAACTGGAAGTGTACAAACTTTAGGTGCATAAATTTACTAAAATAGGAAAGTAATGTGGTGCC[T/A]
AAAAAGGAAACTATGTGGAGGAGGGGGGGATGATCACTAGGGGCGATCGATTGCCCGTTAGCCTTTTTGGATGTTTCATGCTTACGTAAGTTTTGTATGT

Reverse complement sequence

ACATACAAAACTTACGTAAGCATGAAACATCCAAAAAGGCTAACGGGCAATCGATCGCCCCTAGTGATCATCCCCCCCTCCTCCACATAGTTTCCTTTTT[A/T]
GGCACCACATTACTTTCCTATTTTAGTAAATTTATGCACCTAAAGTTTGTACACTTCCAGTTTACACATCTAAATTTTATACACATAAAGTTTAGAGACC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	39.90%	26.60%	13.56%	19.91%	NA
All Indica	2759	54.80%	8.00%	17.04%	20.12%	NA
All Japonica	1512	7.50%	66.90%	7.14%	18.45%	NA
Aus	269	61.70%	0.40%	14.50%	23.42%	NA
Indica I	595	40.20%	4.50%	36.64%	18.66%	NA
Indica II	465	51.80%	15.50%	10.32%	22.37%	NA
Indica III	913	68.10%	3.90%	9.09%	18.84%	NA
Indica Intermediate	786	52.20%	11.10%	15.39%	21.37%	NA
Temperate Japonica	767	8.00%	65.30%	4.82%	21.90%	NA
Tropical Japonica	504	6.70%	62.70%	11.11%	19.44%	NA
Japonica Intermediate	241	7.90%	80.50%	6.22%	5.39%	NA
VI/Aromatic	96	61.50%	0.00%	13.54%	25.00%	NA
Intermediate	90	38.90%	26.70%	12.22%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405532107	T -> DEL	N	N	silent_mutation	Average:39.399; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0405532107	T -> A	LOC_Os04g10240.1	upstream_gene_variant ; 1761.0bp to feature; MODIFIER	silent_mutation	Average:39.399; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0405532107	T -> A	LOC_Os04g10250.1	upstream_gene_variant ; 2850.0bp to feature; MODIFIER	silent_mutation	Average:39.399; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0405532107	T -> A	LOC_Os04g10240.2	upstream_gene_variant ; 1761.0bp to feature; MODIFIER	silent_mutation	Average:39.399; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0405532107	T -> A	LOC_Os04g10240-LOC_Os04g10250	intergenic_region ; MODIFIER	silent_mutation	Average:39.399; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405532107	1.01E-18	2.22E-34	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	2.89E-10	2.11E-12	mr1035	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	1.44E-08	1.01E-11	mr1035	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	2.82E-11	3.72E-27	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	4.25E-06	1.06E-09	mr1062	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	6.77E-12	1.59E-08	mr1525	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	4.45E-08	4.45E-08	mr1525	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	4.13E-18	7.30E-31	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	8.67E-10	2.98E-11	mr1626	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	4.49E-09	1.52E-12	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	3.32E-16	1.73E-41	mr1631	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	1.34E-08	6.57E-10	mr1631	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	5.05E-10	5.05E-10	mr1631	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	9.18E-21	3.90E-33	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	3.05E-06	3.05E-06	mr1035_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	1.39E-10	3.11E-14	mr1035_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	1.49E-18	2.64E-35	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	2.34E-07	3.36E-07	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	8.12E-10	2.67E-13	mr1062_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	1.85E-09	1.91E-09	mr1525_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	6.67E-07	9.26E-08	mr1525_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	6.84E-10	6.84E-10	mr1525_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	3.64E-22	1.07E-53	mr1631_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	2.66E-07	3.84E-08	mr1631_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107	6.13E-11	4.92E-16	mr1631_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251