\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405532107:

Variant ID: vg0405532107 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5532107
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.83, A: 0.19, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:


GGTCTCTAAACTTTATGTGTATAAAATTTAGATGTGTAAACTGGAAGTGTACAAACTTTAGGTGCATAAATTTACTAAAATAGGAAAGTAATGTGGTGCC[T/A]
AAAAAGGAAACTATGTGGAGGAGGGGGGGATGATCACTAGGGGCGATCGATTGCCCGTTAGCCTTTTTGGATGTTTCATGCTTACGTAAGTTTTGTATGT

Reverse complement sequence

ACATACAAAACTTACGTAAGCATGAAACATCCAAAAAGGCTAACGGGCAATCGATCGCCCCTAGTGATCATCCCCCCCTCCTCCACATAGTTTCCTTTTT[A/T]
GGCACCACATTACTTTCCTATTTTAGTAAATTTATGCACCTAAAGTTTGTACACTTCCAGTTTACACATCTAAATTTTATACACATAAAGTTTAGAGACC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 39.90% 26.60% 13.56% 19.91% NA
All Indica  2759 54.80% 8.00% 17.04% 20.12% NA
All Japonica  1512 7.50% 66.90% 7.14% 18.45% NA
Aus  269 61.70% 0.40% 14.50% 23.42% NA
Indica I  595 40.20% 4.50% 36.64% 18.66% NA
Indica II  465 51.80% 15.50% 10.32% 22.37% NA
Indica III  913 68.10% 3.90% 9.09% 18.84% NA
Indica Intermediate  786 52.20% 11.10% 15.39% 21.37% NA
Temperate Japonica  767 8.00% 65.30% 4.82% 21.90% NA
Tropical Japonica  504 6.70% 62.70% 11.11% 19.44% NA
Japonica Intermediate  241 7.90% 80.50% 6.22% 5.39% NA
VI/Aromatic  96 61.50% 0.00% 13.54% 25.00% NA
Intermediate  90 38.90% 26.70% 12.22% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405532107 T -> DEL N N silent_mutation Average:39.399; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0405532107 T -> A LOC_Os04g10240.1 upstream_gene_variant ; 1761.0bp to feature; MODIFIER silent_mutation Average:39.399; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0405532107 T -> A LOC_Os04g10250.1 upstream_gene_variant ; 2850.0bp to feature; MODIFIER silent_mutation Average:39.399; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0405532107 T -> A LOC_Os04g10240.2 upstream_gene_variant ; 1761.0bp to feature; MODIFIER silent_mutation Average:39.399; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0405532107 T -> A LOC_Os04g10240-LOC_Os04g10250 intergenic_region ; MODIFIER silent_mutation Average:39.399; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405532107 1.01E-18 2.22E-34 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 2.89E-10 2.11E-12 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 1.44E-08 1.01E-11 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 2.82E-11 3.72E-27 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 4.25E-06 1.06E-09 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 6.77E-12 1.59E-08 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 4.45E-08 4.45E-08 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 4.13E-18 7.30E-31 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 8.67E-10 2.98E-11 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 4.49E-09 1.52E-12 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 3.32E-16 1.73E-41 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 1.34E-08 6.57E-10 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 5.05E-10 5.05E-10 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 9.18E-21 3.90E-33 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 3.05E-06 3.05E-06 mr1035_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 1.39E-10 3.11E-14 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 1.49E-18 2.64E-35 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 2.34E-07 3.36E-07 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 8.12E-10 2.67E-13 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 1.85E-09 1.91E-09 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 6.67E-07 9.26E-08 mr1525_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 6.84E-10 6.84E-10 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 3.64E-22 1.07E-53 mr1631_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 2.66E-07 3.84E-08 mr1631_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405532107 6.13E-11 4.92E-16 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251