Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405531572:

Variant ID: vg0405531572 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 5531572
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.85, G: 0.14, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

GATGTGTGGCTAATGGGCGGGTAATCGCCCAGCGATCGCCCCCATCCCCCGATACGCTCCTCTCCCCCTTCCTCCTCCCCTTCTTCTCTTCCTACTACAC[C/G]
ATAAATTTTTTTAAAAAAATAAGAAAATAAAGTTAGAAAAATTTATGTATGGAAATACATATATATAAAATATTTGAATTCAAGTTCAAATTTGAAACGG

Reverse complement sequence

CCGTTTCAAATTTGAACTTGAATTCAAATATTTTATATATATGTATTTCCATACATAAATTTTTCTAACTTTATTTTCTTATTTTTTTAAAAAAATTTAT[G/C]
GTGTAGTAGGAAGAGAAGAAGGGGAGGAGGAAGGGGGAGAGGAGCGTATCGGGGGATGGGGGCGATCGCTGGGCGATTACCCGCCCATTAGCCACACATC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.60%	34.50%	3.72%	1.18%	NA
All Indica	2759	88.50%	8.70%	2.46%	0.36%	NA
All Japonica	1512	1.90%	88.60%	6.48%	2.98%	NA
Aus	269	98.50%	0.40%	1.12%	0.00%	NA
Indica I	595	93.90%	3.90%	2.02%	0.17%	NA
Indica II	465	79.80%	14.80%	4.52%	0.86%	NA
Indica III	913	91.70%	6.90%	1.31%	0.11%	NA
Indica Intermediate	786	85.80%	10.80%	2.93%	0.51%	NA
Temperate Japonica	767	0.50%	88.50%	5.74%	5.22%	NA
Tropical Japonica	504	2.80%	88.30%	8.33%	0.60%	NA
Japonica Intermediate	241	4.60%	89.60%	4.98%	0.83%	NA
VI/Aromatic	96	88.50%	10.40%	1.04%	0.00%	NA
Intermediate	90	48.90%	43.30%	6.67%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0405531572	C -> DEL	N	N	silent_mutation	Average:27.752; most accessible tissue: Callus, score: 44.172	N	N	N	N
vg0405531572	C -> G	LOC_Os04g10240.1	upstream_gene_variant ; 1226.0bp to feature; MODIFIER	silent_mutation	Average:27.752; most accessible tissue: Callus, score: 44.172	N	N	N	N
vg0405531572	C -> G	LOC_Os04g10250.1	upstream_gene_variant ; 3385.0bp to feature; MODIFIER	silent_mutation	Average:27.752; most accessible tissue: Callus, score: 44.172	N	N	N	N
vg0405531572	C -> G	LOC_Os04g10240.2	upstream_gene_variant ; 1226.0bp to feature; MODIFIER	silent_mutation	Average:27.752; most accessible tissue: Callus, score: 44.172	N	N	N	N
vg0405531572	C -> G	LOC_Os04g10240-LOC_Os04g10250	intergenic_region ; MODIFIER	silent_mutation	Average:27.752; most accessible tissue: Callus, score: 44.172	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0405531572	4.96E-08	2.22E-20	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531572	9.33E-11	2.79E-13	mr1035	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531572	NA	1.03E-14	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531572	NA	7.15E-13	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531572	3.10E-06	1.72E-16	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531572	4.55E-10	8.86E-12	mr1626	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531572	2.29E-06	3.51E-32	mr1631	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531572	2.70E-08	9.56E-10	mr1631	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531572	NA	1.53E-16	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531572	4.00E-06	4.00E-06	mr1035_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531572	NA	8.43E-20	mr1062_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531572	6.95E-07	1.89E-07	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531572	NA	1.69E-06	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531572	NA	5.79E-07	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531572	8.64E-07	1.35E-07	mr1525_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531572	NA	1.53E-34	mr1631_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531572	4.23E-06	4.10E-07	mr1631_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531572	NA	6.61E-15	mr1686_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531572	NA	7.12E-16	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251