\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405531121:

Variant ID: vg0405531121 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5531121
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.89, G: 0.10, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


GTGTTATCGTGGGTAAGTACACACCCGGACTTACTGAGACTTGCCACTTGGTAGAGAGGCTCAAATGTTATTGCCTCACATCAAAGAAAATTAAGTTAAA[G/C]
GAGCTTAATTTGGTTGATGTTTCTATAGTCACTAGGAATTCCCCACGCTTTGATGTTTCTATAATCACTAGGAATTGCCCACGATGTGCTGGGGAAATTC

Reverse complement sequence

GAATTTCCCCAGCACATCGTGGGCAATTCCTAGTGATTATAGAAACATCAAAGCGTGGGGAATTCCTAGTGACTATAGAAACATCAACCAAATTAAGCTC[C/G]
TTTAACTTAATTTTCTTTGATGTGAGGCAATAACATTTGAGCCTCTCTACCAAGTGGCAAGTCTCAGTAAGTCCGGGTGTGTACTTACCCACGATAACAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.70% 26.10% 0.17% 0.00% NA
All Indica  2759 92.40% 7.40% 0.14% 0.00% NA
All Japonica  1512 33.30% 66.50% 0.20% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 96.00% 4.00% 0.00% 0.00% NA
Indica II  465 85.40% 14.20% 0.43% 0.00% NA
Indica III  913 96.30% 3.50% 0.22% 0.00% NA
Indica Intermediate  786 89.40% 10.60% 0.00% 0.00% NA
Temperate Japonica  767 34.80% 64.90% 0.26% 0.00% NA
Tropical Japonica  504 37.30% 62.50% 0.20% 0.00% NA
Japonica Intermediate  241 20.30% 79.70% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 73.30% 25.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405531121 G -> C LOC_Os04g10240.1 upstream_gene_variant ; 775.0bp to feature; MODIFIER silent_mutation Average:62.523; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N
vg0405531121 G -> C LOC_Os04g10250.1 upstream_gene_variant ; 3836.0bp to feature; MODIFIER silent_mutation Average:62.523; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N
vg0405531121 G -> C LOC_Os04g10240.2 upstream_gene_variant ; 775.0bp to feature; MODIFIER silent_mutation Average:62.523; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N
vg0405531121 G -> C LOC_Os04g10240-LOC_Os04g10250 intergenic_region ; MODIFIER silent_mutation Average:62.523; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405531121 8.63E-19 5.23E-34 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 2.75E-09 3.56E-11 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 5.40E-09 4.85E-12 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 1.11E-12 1.18E-28 mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 1.67E-06 4.02E-10 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 8.69E-14 8.01E-10 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 4.28E-06 2.37E-06 mr1525 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 1.28E-08 1.28E-08 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 1.82E-17 5.82E-30 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 6.99E-09 3.33E-10 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 2.02E-09 6.27E-13 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 1.95E-15 3.58E-40 mr1631 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 1.04E-08 9.20E-10 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 7.91E-10 7.91E-10 mr1631 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 1.66E-19 5.42E-32 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 2.06E-10 3.96E-14 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 5.20E-22 1.88E-38 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 2.25E-08 5.81E-08 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 9.42E-11 4.57E-14 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 3.36E-11 3.48E-11 mr1525_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 1.33E-07 1.71E-08 mr1525_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 1.15E-10 1.15E-10 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 7.76E-20 7.34E-51 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 5.80E-06 1.07E-06 mr1631_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405531121 7.43E-11 5.87E-16 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251