\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0405502839:

Variant ID: vg0405502839 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 5502839
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:


ACCAATCCATCAGTGTAGACCTTTGCCATATCATCTGATGTGTTACTATATCCTAGCTGCTCATCTTACCGGTTTGACTCTTTGGCTGTCGCCAACAATG[C/T]
GAGGTTCACCGCACCGAAACTACCGATGCATCACTCGTGCAACAACTTGCAAGATATCAACAATCATGTAGCCCTGGCTGTGATGCCTTTCTAGGAACAC

Reverse complement sequence

GTGTTCCTAGAAAGGCATCACAGCCAGGGCTACATGATTGTTGATATCTTGCAAGTTGTTGCACGAGTGATGCATCGGTAGTTTCGGTGCGGTGAACCTC[G/A]
CATTGTTGGCGACAGCCAAAGAGTCAAACCGGTAAGATGAGCAGCTAGGATATAGTAACACATCAGATGATATGGCAAAGGTCTACACTGATGGATTGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 8.80% 0.00% 0.00% NA
All Indica  2759 96.30% 3.70% 0.00% 0.00% NA
All Japonica  1512 80.60% 19.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 91.30% 8.70% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.40% 0.00% 0.00% NA
Temperate Japonica  767 80.30% 19.70% 0.00% 0.00% NA
Tropical Japonica  504 76.40% 23.60% 0.00% 0.00% NA
Japonica Intermediate  241 90.00% 10.00% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0405502839 C -> T LOC_Os04g10170.1 upstream_gene_variant ; 1520.0bp to feature; MODIFIER silent_mutation Average:53.109; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N
vg0405502839 C -> T LOC_Os04g10180.1 downstream_gene_variant ; 3106.0bp to feature; MODIFIER silent_mutation Average:53.109; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N
vg0405502839 C -> T LOC_Os04g10160-LOC_Os04g10170 intergenic_region ; MODIFIER silent_mutation Average:53.109; most accessible tissue: Zhenshan97 young leaf, score: 82.31 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0405502839 7.00E-07 NA mr1035 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405502839 7.02E-06 2.95E-06 mr1035 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405502839 3.35E-08 NA mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405502839 9.82E-07 9.33E-10 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405502839 6.69E-08 3.65E-08 mr1525 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405502839 1.08E-07 1.08E-07 mr1525 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405502839 1.59E-07 NA mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405502839 2.26E-06 2.43E-07 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405502839 4.24E-08 NA mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405502839 6.54E-07 9.00E-08 mr1035_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405502839 1.11E-09 NA mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405502839 1.97E-07 3.24E-10 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405502839 5.03E-08 5.02E-08 mr1525_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405502839 1.33E-06 1.33E-06 mr1525_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405502839 2.35E-12 NA mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0405502839 3.01E-10 2.50E-12 mr1631_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251