\
| Variant ID: vg0405493285 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 5493285 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.83, G: 0.18, others allele: 0.00, population size: 204. )
GCGATTGGGGTAGCTGGTTTCTTCCACTTGTTCCGTGTTCCACTTGTTCCGTGAGACCAAGAGTTACGTAAAGCATGCAAATCAGACACGTGAGAAAACA[A/G]
TAACTATTTTTCAAATTCTCCCAACTTTCATTACTTTGGTTATTCCATTCCAGAAGGATGTCATCATGGACATTGACACGGTCTCCAATGCATGTGTTTT
AAAACACATGCATTGGAGACCGTGTCAATGTCCATGATGACATCCTTCTGGAATGGAATAACCAAAGTAATGAAAGTTGGGAGAATTTGAAAAATAGTTA[T/C]
TGTTTTCTCACGTGTCTGATTTGCATGCTTTACGTAACTCTTGGTCTCACGGAACAAGTGGAACACGGAACAAGTGGAAGAAACCAGCTACCCCAATCGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.40% | 37.10% | 0.13% | 0.34% | NA |
| All Indica | 2759 | 90.80% | 9.20% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 2.70% | 96.00% | 0.33% | 0.99% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 84.70% | 15.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.30% | 7.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.50% | 11.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.50% | 99.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 5.00% | 91.30% | 0.79% | 2.98% | NA |
| Japonica Intermediate | 241 | 5.00% | 95.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 90.60% | 9.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 45.60% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0405493285 | A -> DEL | N | N | silent_mutation | Average:30.887; most accessible tissue: Callus, score: 72.029 | N | N | N | N |
| vg0405493285 | A -> G | LOC_Os04g10160-LOC_Os04g10170 | intergenic_region ; MODIFIER | silent_mutation | Average:30.887; most accessible tissue: Callus, score: 72.029 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0405493285 | 8.13E-08 | 4.75E-20 | mr1035 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405493285 | 4.35E-08 | 4.16E-10 | mr1035 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405493285 | 9.16E-07 | 2.69E-18 | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405493285 | 3.83E-06 | 2.43E-06 | mr1062 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405493285 | 6.29E-07 | NA | mr1525 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405493285 | 9.61E-08 | 1.39E-07 | mr1525 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405493285 | NA | 1.16E-15 | mr1626 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405493285 | 4.01E-07 | 1.88E-08 | mr1626 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405493285 | 3.92E-06 | 6.64E-32 | mr1631 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405493285 | 1.70E-06 | 1.36E-07 | mr1631 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405493285 | NA | 4.15E-18 | mr1715 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405493285 | 1.35E-07 | 1.90E-18 | mr1035_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405493285 | 1.79E-06 | 1.79E-06 | mr1035_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405493285 | 4.85E-06 | 1.81E-20 | mr1062_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405493285 | 3.25E-08 | 4.20E-08 | mr1062_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405493285 | NA | 2.02E-06 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405493285 | NA | 1.14E-64 | mr1402_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405493285 | NA | 7.77E-07 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405493285 | 3.89E-07 | 9.40E-08 | mr1525_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405493285 | 7.63E-07 | 1.50E-37 | mr1631_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405493285 | 1.69E-06 | 2.55E-07 | mr1631_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0405493285 | NA | 2.96E-11 | mr1986_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |